Multiple sequence alignment - TraesCS5A01G508100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G508100 chr5A 100.000 3113 0 0 1 3113 672511132 672508020 0.000000e+00 5749
1 TraesCS5A01G508100 chr5A 88.088 680 70 11 1408 2083 672823767 672823095 0.000000e+00 797
2 TraesCS5A01G508100 chr5A 84.416 462 50 13 920 1364 672827040 672826584 4.770000e-118 435
3 TraesCS5A01G508100 chr5A 82.162 185 27 5 2843 3025 593173337 593173517 1.500000e-33 154
4 TraesCS5A01G508100 chr4D 97.498 2918 33 7 222 3113 492816130 492813227 0.000000e+00 4948
5 TraesCS5A01G508100 chr4D 85.061 1225 132 31 1364 2556 491949929 491948724 0.000000e+00 1201
6 TraesCS5A01G508100 chr4D 84.825 1173 135 26 1408 2556 493757338 493758491 0.000000e+00 1140
7 TraesCS5A01G508100 chr4D 85.823 790 87 16 587 1364 491952630 491951854 0.000000e+00 815
8 TraesCS5A01G508100 chr4D 84.632 462 52 11 920 1364 493738527 493738986 2.850000e-120 442
9 TraesCS5A01G508100 chr4D 83.270 526 37 24 2 489 491953150 491952638 1.330000e-118 436
10 TraesCS5A01G508100 chr4D 82.938 211 24 12 2911 3113 238760936 238761142 2.470000e-41 180
11 TraesCS5A01G508100 chr4B 98.843 2161 23 1 929 3089 631070472 631072630 0.000000e+00 3851
12 TraesCS5A01G508100 chr4B 93.901 787 17 5 1 786 631069718 631070474 0.000000e+00 1158
13 TraesCS5A01G508100 chr4B 84.013 1226 148 33 1364 2556 631529170 631527960 0.000000e+00 1134
14 TraesCS5A01G508100 chr4B 84.665 463 50 13 920 1364 631531359 631530900 2.850000e-120 442
15 TraesCS5A01G508100 chr1D 81.413 269 37 11 2841 3101 156126763 156126500 1.130000e-49 207
16 TraesCS5A01G508100 chr1A 79.705 271 37 14 2854 3112 324524041 324523777 2.470000e-41 180
17 TraesCS5A01G508100 chr6D 79.044 272 39 17 2843 3101 289507425 289507691 1.480000e-38 171
18 TraesCS5A01G508100 chr3D 78.596 285 39 20 2841 3112 28680410 28680135 5.340000e-38 169
19 TraesCS5A01G508100 chr3D 82.550 149 12 12 2274 2416 30429280 30429420 5.450000e-23 119
20 TraesCS5A01G508100 chr3D 80.488 164 19 10 2274 2431 30675091 30674935 2.540000e-21 113
21 TraesCS5A01G508100 chr7A 81.592 201 28 9 2845 3044 167844266 167844458 1.160000e-34 158
22 TraesCS5A01G508100 chr2A 77.778 270 39 16 2845 3100 513641080 513641342 2.500000e-31 147
23 TraesCS5A01G508100 chr3B 80.488 164 20 11 2274 2431 53354856 53354699 7.050000e-22 115
24 TraesCS5A01G508100 chr3B 81.879 149 14 12 2274 2416 53217722 53217581 2.540000e-21 113
25 TraesCS5A01G508100 chr3A 80.488 164 20 11 2274 2431 42366546 42366389 7.050000e-22 115


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G508100 chr5A 672508020 672511132 3112 True 5749.000000 5749 100.000 1 3113 1 chr5A.!!$R1 3112
1 TraesCS5A01G508100 chr5A 672823095 672827040 3945 True 616.000000 797 86.252 920 2083 2 chr5A.!!$R2 1163
2 TraesCS5A01G508100 chr4D 492813227 492816130 2903 True 4948.000000 4948 97.498 222 3113 1 chr4D.!!$R1 2891
3 TraesCS5A01G508100 chr4D 493757338 493758491 1153 False 1140.000000 1140 84.825 1408 2556 1 chr4D.!!$F3 1148
4 TraesCS5A01G508100 chr4D 491948724 491953150 4426 True 817.333333 1201 84.718 2 2556 3 chr4D.!!$R2 2554
5 TraesCS5A01G508100 chr4B 631069718 631072630 2912 False 2504.500000 3851 96.372 1 3089 2 chr4B.!!$F1 3088
6 TraesCS5A01G508100 chr4B 631527960 631531359 3399 True 788.000000 1134 84.339 920 2556 2 chr4B.!!$R1 1636

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
113 116 1.897802 GAGGTTACCAACTTCCCTCGA 59.102 52.381 3.51 0.00 33.02 4.04 F
715 781 4.560128 TCTTAATGCCTTATCGCTAGCAG 58.440 43.478 16.45 7.87 38.89 4.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1592 4695 8.221944 TGGTCAATAATAATCGGGGAAATAAGT 58.778 33.333 0.00 0.0 0.0 2.24 R
2237 5356 8.474006 AAAAACATAAGTGACACCAGAAAAAC 57.526 30.769 0.84 0.0 0.0 2.43 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
113 116 1.897802 GAGGTTACCAACTTCCCTCGA 59.102 52.381 3.51 0.00 33.02 4.04
140 143 6.207928 TGGCTCAATTATTGATTTGCGTATG 58.792 36.000 8.17 0.00 39.30 2.39
190 199 8.370493 TGTATCTATTATTCTGCTTCAAGTGC 57.630 34.615 0.00 0.00 0.00 4.40
352 391 8.547967 AAATCGTAGTACATCAAGTGATTTGT 57.452 30.769 0.38 0.00 38.01 2.83
715 781 4.560128 TCTTAATGCCTTATCGCTAGCAG 58.440 43.478 16.45 7.87 38.89 4.24
759 827 5.414454 TCTCAGCTAGTTTCTCACTCTCTTC 59.586 44.000 0.00 0.00 36.88 2.87
760 828 5.073428 TCAGCTAGTTTCTCACTCTCTTCA 58.927 41.667 0.00 0.00 36.88 3.02
982 1063 9.467258 CTTGTTGTAAATGACATTGTTTCATCT 57.533 29.630 0.34 0.00 38.07 2.90
993 1074 5.487488 ACATTGTTTCATCTACTCCAGGGTA 59.513 40.000 0.00 0.00 0.00 3.69
1591 4694 7.739022 TCGTCGTATTCTCGCTTTTATTTTA 57.261 32.000 0.00 0.00 0.00 1.52
1592 4695 8.172159 TCGTCGTATTCTCGCTTTTATTTTAA 57.828 30.769 0.00 0.00 0.00 1.52
2110 5214 5.480422 GGGATTTCCACTTGTAAAATCACCT 59.520 40.000 15.93 0.00 39.86 4.00
2673 5798 9.998106 GGCTTATCAATGTTTCTACTCCTATTA 57.002 33.333 0.00 0.00 0.00 0.98
2852 5977 5.995446 AGTCTAGGAAATTTAAGGCCTCTG 58.005 41.667 5.23 0.00 32.04 3.35
2979 6104 7.784470 ATGTAGGATAGGAATCAGTACTTCC 57.216 40.000 4.16 4.16 42.13 3.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
16 17 2.107950 ATGAAAATCTTGCCGTCGGA 57.892 45.000 17.49 0.0 0.00 4.55
113 116 5.104374 CGCAAATCAATAATTGAGCCAGTT 58.896 37.500 0.00 0.0 43.98 3.16
140 143 4.461081 AGATATGTCTATCCGGAAGCTGTC 59.539 45.833 9.01 0.0 35.31 3.51
190 199 5.099575 ACGTGTTGGCTAAAAGAAAACAAG 58.900 37.500 0.00 0.0 36.64 3.16
462 501 4.276926 ACTGATTTTTCTGTTGACCTGCTC 59.723 41.667 0.00 0.0 0.00 4.26
584 649 2.361104 GGAACCGCCATGGCAAGA 60.361 61.111 34.93 0.0 43.94 3.02
715 781 5.410746 TGAGATGACAGCAAGAAAACAGATC 59.589 40.000 0.00 0.0 0.00 2.75
759 827 6.655003 ACATCAAACACCTCAACTAACCTATG 59.345 38.462 0.00 0.0 0.00 2.23
760 828 6.779860 ACATCAAACACCTCAACTAACCTAT 58.220 36.000 0.00 0.0 0.00 2.57
982 1063 2.693074 GCATCTTCCCTACCCTGGAGTA 60.693 54.545 0.00 0.0 32.37 2.59
993 1074 2.592102 TGCTTTTCTGCATCTTCCCT 57.408 45.000 0.00 0.0 38.12 4.20
1591 4694 9.074576 GGTCAATAATAATCGGGGAAATAAGTT 57.925 33.333 0.00 0.0 0.00 2.66
1592 4695 8.221944 TGGTCAATAATAATCGGGGAAATAAGT 58.778 33.333 0.00 0.0 0.00 2.24
2110 5214 9.448438 CAAGCAGGCAAAATATACATATACCTA 57.552 33.333 0.00 0.0 0.00 3.08
2237 5356 8.474006 AAAAACATAAGTGACACCAGAAAAAC 57.526 30.769 0.84 0.0 0.00 2.43
2799 5924 8.300286 TCCGTAGATCACTCAAATATCTCAATC 58.700 37.037 0.00 0.0 32.39 2.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.