Multiple sequence alignment - TraesCS5A01G507200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G507200 chr5A 100.000 3466 0 0 1 3466 671822600 671819135 0.000000e+00 6401.0
1 TraesCS5A01G507200 chr5A 99.051 3477 19 4 1 3464 671754611 671751136 0.000000e+00 6226.0
2 TraesCS5A01G507200 chr5A 97.662 3507 25 11 1 3466 671625465 671621975 0.000000e+00 5969.0
3 TraesCS5A01G507200 chr5A 86.396 713 89 6 1573 2281 641725397 641726105 0.000000e+00 773.0
4 TraesCS5A01G507200 chr5A 90.551 127 9 3 2694 2818 536827550 536827425 7.700000e-37 165.0
5 TraesCS5A01G507200 chr5A 85.034 147 18 3 2695 2837 581923728 581923874 2.790000e-31 147.0
6 TraesCS5A01G507200 chr4D 93.333 2190 95 27 479 2629 490331463 490329286 0.000000e+00 3188.0
7 TraesCS5A01G507200 chr4D 93.845 2047 86 23 615 2629 490975477 490977515 0.000000e+00 3046.0
8 TraesCS5A01G507200 chr4D 93.279 491 30 3 1 488 490346618 490346128 0.000000e+00 721.0
9 TraesCS5A01G507200 chr4D 83.843 229 27 8 3238 3465 464191611 464191392 3.510000e-50 209.0
10 TraesCS5A01G507200 chr4D 90.323 124 11 1 2696 2818 256549821 256549944 9.960000e-36 161.0
11 TraesCS5A01G507200 chr4B 93.085 1851 84 27 650 2472 629963561 629961727 0.000000e+00 2669.0
12 TraesCS5A01G507200 chr4B 91.019 579 41 6 77 653 629964883 629964314 0.000000e+00 771.0
13 TraesCS5A01G507200 chr4B 100.000 30 0 0 1 30 629964913 629964884 4.830000e-04 56.5
14 TraesCS5A01G507200 chr5D 86.396 713 89 6 1573 2281 513926335 513927043 0.000000e+00 773.0
15 TraesCS5A01G507200 chr5B 86.255 713 90 7 1573 2281 644874555 644875263 0.000000e+00 767.0
16 TraesCS5A01G507200 chr3D 84.337 249 25 10 3228 3464 109022850 109023096 7.480000e-57 231.0
17 TraesCS5A01G507200 chr2B 84.783 230 31 3 3231 3456 689745386 689745157 9.680000e-56 228.0
18 TraesCS5A01G507200 chr3B 84.279 229 30 5 3231 3457 499802905 499802681 5.820000e-53 219.0
19 TraesCS5A01G507200 chr2D 84.141 227 29 6 3242 3465 598234433 598234655 2.710000e-51 213.0
20 TraesCS5A01G507200 chr1D 82.627 236 36 5 3232 3466 425203282 425203051 1.630000e-48 204.0
21 TraesCS5A01G507200 chr1D 81.743 241 35 8 3228 3461 360891816 360892054 3.530000e-45 193.0
22 TraesCS5A01G507200 chr1D 90.833 120 10 1 2700 2818 246416532 246416413 3.580000e-35 159.0
23 TraesCS5A01G507200 chr7B 82.278 237 39 3 3231 3465 584304059 584303824 5.870000e-48 202.0
24 TraesCS5A01G507200 chr2A 92.373 118 8 1 2701 2818 194551858 194551974 2.140000e-37 167.0
25 TraesCS5A01G507200 chr2A 90.756 119 7 4 2691 2808 729352831 729352716 4.630000e-34 156.0
26 TraesCS5A01G507200 chr6A 87.407 135 14 2 2685 2818 38404636 38404504 5.990000e-33 152.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G507200 chr5A 671819135 671822600 3465 True 6401.0 6401 100.000000 1 3466 1 chr5A.!!$R4 3465
1 TraesCS5A01G507200 chr5A 671751136 671754611 3475 True 6226.0 6226 99.051000 1 3464 1 chr5A.!!$R3 3463
2 TraesCS5A01G507200 chr5A 671621975 671625465 3490 True 5969.0 5969 97.662000 1 3466 1 chr5A.!!$R2 3465
3 TraesCS5A01G507200 chr5A 641725397 641726105 708 False 773.0 773 86.396000 1573 2281 1 chr5A.!!$F2 708
4 TraesCS5A01G507200 chr4D 490329286 490331463 2177 True 3188.0 3188 93.333000 479 2629 1 chr4D.!!$R2 2150
5 TraesCS5A01G507200 chr4D 490975477 490977515 2038 False 3046.0 3046 93.845000 615 2629 1 chr4D.!!$F2 2014
6 TraesCS5A01G507200 chr4B 629961727 629964913 3186 True 1165.5 2669 94.701333 1 2472 3 chr4B.!!$R1 2471
7 TraesCS5A01G507200 chr5D 513926335 513927043 708 False 773.0 773 86.396000 1573 2281 1 chr5D.!!$F1 708
8 TraesCS5A01G507200 chr5B 644874555 644875263 708 False 767.0 767 86.255000 1573 2281 1 chr5B.!!$F1 708

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
250 251 1.562017 GCGTTTTCTTTTTGCGGGAA 58.438 45.0 0.0 0.0 0.0 3.97 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2643 3455 4.100035 TGATTCACTCGTATGCCTCATCTT 59.9 41.667 0.0 0.0 0.0 2.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
250 251 1.562017 GCGTTTTCTTTTTGCGGGAA 58.438 45.000 0.00 0.00 0.00 3.97
2671 3483 3.386078 AGGCATACGAGTGAATCATCAGT 59.614 43.478 0.00 0.00 41.99 3.41
3050 3889 1.090625 TGGTTGTTGCTTACGTGCGT 61.091 50.000 0.00 2.05 35.36 5.24
3061 3900 4.100529 GCTTACGTGCGTTAGTTCTATGA 58.899 43.478 11.44 0.00 0.00 2.15
3075 3914 0.184451 CTATGAGGCCTTGGCATGGT 59.816 55.000 19.40 1.87 0.00 3.55
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
250 251 9.118300 CATCTCTAGCTGAACTCCAAATTTTAT 57.882 33.333 0.00 0.0 0.00 1.40
417 419 2.450476 GTGCCTGAAGAATTGACCCAT 58.550 47.619 0.00 0.0 0.00 4.00
2643 3455 4.100035 TGATTCACTCGTATGCCTCATCTT 59.900 41.667 0.00 0.0 0.00 2.40
2659 3471 4.159135 AGGGATGCAAAACTGATGATTCAC 59.841 41.667 0.00 0.0 0.00 3.18
2671 3483 8.841300 GTTTAAAACCAAAATAGGGATGCAAAA 58.159 29.630 0.00 0.0 0.00 2.44
2772 3610 8.801882 AAGGAAAAATATCCACACGAATCTTA 57.198 30.769 0.00 0.0 42.27 2.10
3050 3889 2.843730 TGCCAAGGCCTCATAGAACTAA 59.156 45.455 5.23 0.0 41.09 2.24
3061 3900 2.252535 AAATTACCATGCCAAGGCCT 57.747 45.000 0.00 0.0 41.09 5.19
3075 3914 8.723311 CCGAATGAACCTTGTTGTAGTAAATTA 58.277 33.333 0.00 0.0 0.00 1.40
3332 4175 4.751098 ACGCACGGTTTAAGAGATAAAACA 59.249 37.500 0.00 0.0 40.57 2.83
3339 4182 0.675083 TGGACGCACGGTTTAAGAGA 59.325 50.000 0.00 0.0 0.00 3.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.