Multiple sequence alignment - TraesCS5A01G507100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G507100 chr5A 100.000 3466 0 0 1 3466 671754603 671751138 0.000000e+00 6401
1 TraesCS5A01G507100 chr5A 99.048 3467 19 4 1 3466 671822592 671819139 0.000000e+00 6207
2 TraesCS5A01G507100 chr5A 98.140 3494 22 18 1 3466 671625457 671621979 0.000000e+00 6052
3 TraesCS5A01G507100 chr5A 86.396 713 89 6 1573 2281 641725397 641726105 0.000000e+00 773
4 TraesCS5A01G507100 chr5A 89.062 128 10 4 2693 2818 536827550 536827425 4.630000e-34 156
5 TraesCS5A01G507100 chr4D 93.519 2191 97 27 471 2629 490331463 490329286 0.000000e+00 3217
6 TraesCS5A01G507100 chr4D 94.043 2048 88 23 607 2629 490975477 490977515 0.000000e+00 3075
7 TraesCS5A01G507100 chr4D 92.961 483 31 3 1 480 490346610 490346128 0.000000e+00 701
8 TraesCS5A01G507100 chr4D 82.609 230 33 7 3235 3460 499591252 499591026 2.730000e-46 196
9 TraesCS5A01G507100 chr4B 93.219 1858 76 26 642 2472 629963561 629961727 0.000000e+00 2687
10 TraesCS5A01G507100 chr4B 90.846 579 42 6 69 645 629964883 629964314 0.000000e+00 765
11 TraesCS5A01G507100 chr5D 86.396 713 89 6 1573 2281 513926335 513927043 0.000000e+00 773
12 TraesCS5A01G507100 chr5B 86.255 713 90 7 1573 2281 644874555 644875263 0.000000e+00 767
13 TraesCS5A01G507100 chr3D 84.711 242 24 9 3232 3461 109022850 109023090 2.690000e-56 230
14 TraesCS5A01G507100 chrUn 91.925 161 12 1 3304 3463 31236065 31235905 1.250000e-54 224
15 TraesCS5A01G507100 chr1D 91.411 163 12 2 3301 3461 423654114 423654276 4.500000e-54 222
16 TraesCS5A01G507100 chr2B 83.913 230 33 3 3235 3460 689745386 689745157 2.090000e-52 217
17 TraesCS5A01G507100 chr3B 82.403 233 33 8 3235 3461 117949046 117949276 2.730000e-46 196
18 TraesCS5A01G507100 chr7B 81.197 234 39 5 3235 3465 584304059 584303828 2.120000e-42 183
19 TraesCS5A01G507100 chr2A 92.437 119 7 1 2700 2818 194551858 194551974 5.950000e-38 169
20 TraesCS5A01G507100 chr6A 93.694 111 7 0 2699 2809 17031891 17032001 2.140000e-37 167
21 TraesCS5A01G507100 chr3A 93.750 112 5 2 2694 2804 54660219 54660329 2.140000e-37 167
22 TraesCS5A01G507100 chr3A 87.879 132 13 3 2690 2818 380910340 380910471 5.990000e-33 152
23 TraesCS5A01G507100 chr1A 89.600 125 9 2 2698 2818 369996650 369996526 4.630000e-34 156
24 TraesCS5A01G507100 chr4A 87.500 136 11 4 2689 2818 186476384 186476519 5.990000e-33 152


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G507100 chr5A 671751138 671754603 3465 True 6401 6401 100.0000 1 3466 1 chr5A.!!$R3 3465
1 TraesCS5A01G507100 chr5A 671819139 671822592 3453 True 6207 6207 99.0480 1 3466 1 chr5A.!!$R4 3465
2 TraesCS5A01G507100 chr5A 671621979 671625457 3478 True 6052 6052 98.1400 1 3466 1 chr5A.!!$R2 3465
3 TraesCS5A01G507100 chr5A 641725397 641726105 708 False 773 773 86.3960 1573 2281 1 chr5A.!!$F1 708
4 TraesCS5A01G507100 chr4D 490329286 490331463 2177 True 3217 3217 93.5190 471 2629 1 chr4D.!!$R1 2158
5 TraesCS5A01G507100 chr4D 490975477 490977515 2038 False 3075 3075 94.0430 607 2629 1 chr4D.!!$F1 2022
6 TraesCS5A01G507100 chr4B 629961727 629964883 3156 True 1726 2687 92.0325 69 2472 2 chr4B.!!$R1 2403
7 TraesCS5A01G507100 chr5D 513926335 513927043 708 False 773 773 86.3960 1573 2281 1 chr5D.!!$F1 708
8 TraesCS5A01G507100 chr5B 644874555 644875263 708 False 767 767 86.2550 1573 2281 1 chr5B.!!$F1 708

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
381 383 4.606961 CATAATGGCGTGGTTTGTAATCC 58.393 43.478 0.0 0.0 0.0 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2802 3634 5.648178 ATTGCATATCAAGCACAAAGTGA 57.352 34.783 0.58 0.0 42.54 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
191 192 5.050295 GGGAGTTCAGTTTTACGAGTTTGAG 60.050 44.000 0.0 0.0 0.0 3.02
381 383 4.606961 CATAATGGCGTGGTTTGTAATCC 58.393 43.478 0.0 0.0 0.0 3.01
2396 3199 4.641645 TGGCACCGCAACCAGGAG 62.642 66.667 0.0 0.0 0.0 3.69
2761 3592 7.360113 TGCACATCTAAGTCCTATGTCATTA 57.640 36.000 0.0 0.0 31.6 1.90
3282 4114 0.763223 AACGTCACTCCCACCTTCCT 60.763 55.000 0.0 0.0 0.0 3.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
191 192 9.256477 CAAATTTGAGTTAAAAAGGGTTCCTAC 57.744 33.333 13.08 0.0 31.13 3.18
404 406 3.834231 CCTGAAGAATTGACCCACCAATT 59.166 43.478 0.00 0.0 46.09 2.32
2802 3634 5.648178 ATTGCATATCAAGCACAAAGTGA 57.352 34.783 0.58 0.0 42.54 3.41
2908 3740 2.556144 AACCTTCCCTCGTAAACACC 57.444 50.000 0.00 0.0 0.00 4.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.