Multiple sequence alignment - TraesCS5A01G504300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G504300 chr5A 100.000 2788 0 0 1 2788 670095902 670098689 0 5149
1 TraesCS5A01G504300 chr2B 98.675 2792 33 3 1 2788 667428989 667431780 0 4948
2 TraesCS5A01G504300 chr7A 98.595 2776 37 2 14 2788 701450095 701447321 0 4909
3 TraesCS5A01G504300 chr2D 98.596 2777 36 3 14 2788 647572092 647569317 0 4909
4 TraesCS5A01G504300 chr2D 98.560 2777 34 6 14 2788 107007475 107004703 0 4902
5 TraesCS5A01G504300 chr3D 98.560 2777 36 4 14 2788 38236205 38233431 0 4903
6 TraesCS5A01G504300 chr3D 98.560 2777 36 4 14 2788 515544419 515547193 0 4903
7 TraesCS5A01G504300 chr3D 98.560 2777 35 5 14 2788 437762706 437759933 0 4902
8 TraesCS5A01G504300 chr5D 98.560 2777 34 5 14 2788 533654915 533652143 0 4902
9 TraesCS5A01G504300 chr1D 98.560 2777 35 5 14 2788 115031522 115028749 0 4902


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G504300 chr5A 670095902 670098689 2787 False 5149 5149 100.000 1 2788 1 chr5A.!!$F1 2787
1 TraesCS5A01G504300 chr2B 667428989 667431780 2791 False 4948 4948 98.675 1 2788 1 chr2B.!!$F1 2787
2 TraesCS5A01G504300 chr7A 701447321 701450095 2774 True 4909 4909 98.595 14 2788 1 chr7A.!!$R1 2774
3 TraesCS5A01G504300 chr2D 647569317 647572092 2775 True 4909 4909 98.596 14 2788 1 chr2D.!!$R2 2774
4 TraesCS5A01G504300 chr2D 107004703 107007475 2772 True 4902 4902 98.560 14 2788 1 chr2D.!!$R1 2774
5 TraesCS5A01G504300 chr3D 38233431 38236205 2774 True 4903 4903 98.560 14 2788 1 chr3D.!!$R1 2774
6 TraesCS5A01G504300 chr3D 515544419 515547193 2774 False 4903 4903 98.560 14 2788 1 chr3D.!!$F1 2774
7 TraesCS5A01G504300 chr3D 437759933 437762706 2773 True 4902 4902 98.560 14 2788 1 chr3D.!!$R2 2774
8 TraesCS5A01G504300 chr5D 533652143 533654915 2772 True 4902 4902 98.560 14 2788 1 chr5D.!!$R1 2774
9 TraesCS5A01G504300 chr1D 115028749 115031522 2773 True 4902 4902 98.560 14 2788 1 chr1D.!!$R1 2774

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
364 369 1.062587 CTCAAATTCGTCATCACGGGC 59.937 52.381 0.0 0.0 46.7 6.13 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2129 2135 2.565834 AGTTCTAGAGGCGCCAAGTTTA 59.434 45.455 31.54 11.83 0.0 2.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
167 172 4.742201 CGGCCAGAGACACACCGG 62.742 72.222 2.24 0.0 40.18 5.28
330 335 3.892588 ACGAATTAGGTTTTTGGGAAGCA 59.107 39.130 0.00 0.0 0.00 3.91
364 369 1.062587 CTCAAATTCGTCATCACGGGC 59.937 52.381 0.00 0.0 46.70 6.13
796 801 5.048434 GCTTACTGCTCTGAAAGTTTTCCAT 60.048 40.000 2.41 0.0 38.95 3.41
1119 1125 6.399639 AAATGTGTTCTACCCGACAAATTT 57.600 33.333 0.00 0.0 38.33 1.82
1215 1221 9.206690 AGACAGGAGATATCAGTTGAAAATCTA 57.793 33.333 5.32 0.0 33.62 1.98
1755 1761 1.332375 GTGCAACTAAGGAACGTGCAA 59.668 47.619 0.00 0.0 32.46 4.08
1770 1776 3.702548 ACGTGCAACATGTCCCTACTATA 59.297 43.478 0.00 0.0 35.74 1.31
1901 1907 2.281484 GTGCGGAGGCTTGTTCCA 60.281 61.111 0.00 0.0 40.82 3.53
2129 2135 0.683973 CATAAGGCTGCCGAGGAGAT 59.316 55.000 13.96 0.0 0.00 2.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
96 101 0.804544 CGGTATTGTGTCGCGACCAT 60.805 55.000 34.34 24.51 0.00 3.55
167 172 3.386726 AGGCAAAACCCTAGGTGTTTTTC 59.613 43.478 25.98 22.86 42.38 2.29
330 335 4.284860 TGAGCAGTCGCGCACAGT 62.285 61.111 8.75 0.00 43.53 3.55
796 801 0.035317 CTGGAGCACCAACACTAGCA 59.965 55.000 3.90 0.00 46.32 3.49
970 976 0.607217 TCACTGCCTGCATCTGTTGG 60.607 55.000 0.00 0.00 0.00 3.77
1119 1125 1.077086 AATCATGCACCCAGCCACA 59.923 52.632 0.00 0.00 44.83 4.17
1755 1761 8.993424 AGATTCTTGTTTATAGTAGGGACATGT 58.007 33.333 0.00 0.00 0.00 3.21
1770 1776 4.833390 AGCCGCTAACTAGATTCTTGTTT 58.167 39.130 16.67 4.24 32.46 2.83
2034 2040 4.909880 GCAACTGTGAAGTTCGGAATTAAC 59.090 41.667 0.00 0.00 0.00 2.01
2129 2135 2.565834 AGTTCTAGAGGCGCCAAGTTTA 59.434 45.455 31.54 11.83 0.00 2.01
2393 2399 8.663167 TCTCATGAATAATACCATGTTCCTCAT 58.337 33.333 0.00 0.00 40.59 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.