Multiple sequence alignment - TraesCS5A01G461600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G461600 chr5A 100.000 4750 0 0 1 4750 641769928 641765179 0 8772
1 TraesCS5A01G461600 chr6B 98.282 4773 57 11 1 4750 482838192 482833422 0 8336
2 TraesCS5A01G461600 chr6B 98.156 4772 63 12 1 4750 482818559 482813791 0 8301
3 TraesCS5A01G461600 chr7B 98.261 4772 59 10 1 4750 75052089 75047320 0 8331
4 TraesCS5A01G461600 chr7B 98.031 4774 67 12 1 4750 628741838 628746608 0 8270
5 TraesCS5A01G461600 chr7B 98.959 3553 35 2 1199 4750 75046064 75042513 0 6355
6 TraesCS5A01G461600 chr7A 98.178 4775 61 6 1 4750 28244722 28249495 0 8312
7 TraesCS5A01G461600 chr2B 98.093 4773 64 13 1 4750 616523001 616518233 0 8285
8 TraesCS5A01G461600 chr2B 98.053 4776 64 13 1 4750 615344295 615339523 0 8277
9 TraesCS5A01G461600 chr3A 97.926 4774 67 14 1 4750 742303656 742308421 0 8239
10 TraesCS5A01G461600 chr2A 98.035 4428 63 10 1 4405 70021021 70016595 0 7673
11 TraesCS5A01G461600 chr6A 98.185 4243 55 9 529 4750 47634132 47638373 0 7389
12 TraesCS5A01G461600 chr6A 98.044 4244 59 10 529 4750 73517031 73521272 0 7356
13 TraesCS5A01G461600 chr1A 98.103 3690 47 9 1083 4750 266887250 266890938 0 6405
14 TraesCS5A01G461600 chrUn 97.548 2243 30 11 1 2220 289561423 289559183 0 3814
15 TraesCS5A01G461600 chrUn 97.146 1577 23 7 1 1557 373067672 373069246 0 2643
16 TraesCS5A01G461600 chr3B 96.536 1299 23 7 1 1277 5523497 5522199 0 2130


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G461600 chr5A 641765179 641769928 4749 True 8772 8772 100.000 1 4750 1 chr5A.!!$R1 4749
1 TraesCS5A01G461600 chr6B 482833422 482838192 4770 True 8336 8336 98.282 1 4750 1 chr6B.!!$R2 4749
2 TraesCS5A01G461600 chr6B 482813791 482818559 4768 True 8301 8301 98.156 1 4750 1 chr6B.!!$R1 4749
3 TraesCS5A01G461600 chr7B 628741838 628746608 4770 False 8270 8270 98.031 1 4750 1 chr7B.!!$F1 4749
4 TraesCS5A01G461600 chr7B 75042513 75052089 9576 True 7343 8331 98.610 1 4750 2 chr7B.!!$R1 4749
5 TraesCS5A01G461600 chr7A 28244722 28249495 4773 False 8312 8312 98.178 1 4750 1 chr7A.!!$F1 4749
6 TraesCS5A01G461600 chr2B 616518233 616523001 4768 True 8285 8285 98.093 1 4750 1 chr2B.!!$R2 4749
7 TraesCS5A01G461600 chr2B 615339523 615344295 4772 True 8277 8277 98.053 1 4750 1 chr2B.!!$R1 4749
8 TraesCS5A01G461600 chr3A 742303656 742308421 4765 False 8239 8239 97.926 1 4750 1 chr3A.!!$F1 4749
9 TraesCS5A01G461600 chr2A 70016595 70021021 4426 True 7673 7673 98.035 1 4405 1 chr2A.!!$R1 4404
10 TraesCS5A01G461600 chr6A 47634132 47638373 4241 False 7389 7389 98.185 529 4750 1 chr6A.!!$F1 4221
11 TraesCS5A01G461600 chr6A 73517031 73521272 4241 False 7356 7356 98.044 529 4750 1 chr6A.!!$F2 4221
12 TraesCS5A01G461600 chr1A 266887250 266890938 3688 False 6405 6405 98.103 1083 4750 1 chr1A.!!$F1 3667
13 TraesCS5A01G461600 chrUn 289559183 289561423 2240 True 3814 3814 97.548 1 2220 1 chrUn.!!$R1 2219
14 TraesCS5A01G461600 chrUn 373067672 373069246 1574 False 2643 2643 97.146 1 1557 1 chrUn.!!$F1 1556
15 TraesCS5A01G461600 chr3B 5522199 5523497 1298 True 2130 2130 96.536 1 1277 1 chr3B.!!$R1 1276

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
509 525 0.600782 GACCCGTCGCCTTGTTTACA 60.601 55.000 0.0 0.0 0.00 2.41 F
1519 6363 1.599047 CCCGCTGATGAGGAACTGT 59.401 57.895 0.0 0.0 41.55 3.55 F
2735 7580 0.833287 ATGAGTGGCTAAGTGGCGAT 59.167 50.000 0.0 0.0 45.14 4.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1569 6413 3.312736 GGATTACCATCCCAACACCAT 57.687 47.619 0.0 0.0 43.29 3.55 R
2892 7737 0.604578 TTCCGGGTCTAACGTGAAGG 59.395 55.000 0.0 0.0 0.00 3.46 R
3757 8605 0.109597 CACATGCAAAACTCCTCCGC 60.110 55.000 0.0 0.0 0.00 5.54 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
31 32 4.280929 GGCAGTATTTTCTGGGTTTTCTGT 59.719 41.667 0.00 0.00 36.12 3.41
509 525 0.600782 GACCCGTCGCCTTGTTTACA 60.601 55.000 0.00 0.00 0.00 2.41
1155 1171 7.934855 AAGAGCACTGATGATGACTTTATTT 57.065 32.000 0.00 0.00 0.00 1.40
1519 6363 1.599047 CCCGCTGATGAGGAACTGT 59.401 57.895 0.00 0.00 41.55 3.55
1569 6413 6.798482 ACAAATACGACTACGAATATGGTCA 58.202 36.000 0.00 0.00 42.66 4.02
1690 6534 7.817478 ACTTGTAGATCGATGACAACATTACAA 59.183 33.333 15.26 9.89 34.85 2.41
1991 6835 7.068593 AGGATGATTGAGAAACTGAACAAAACA 59.931 33.333 0.00 0.00 0.00 2.83
2679 7524 5.943349 TTTCAATGATGGCATGGAAGAAT 57.057 34.783 3.81 0.00 43.48 2.40
2735 7580 0.833287 ATGAGTGGCTAAGTGGCGAT 59.167 50.000 0.00 0.00 45.14 4.58
2892 7737 5.010282 ACAACTTGGAGGATACATTGGTTC 58.990 41.667 0.00 0.00 41.41 3.62
3346 8191 6.726490 AGATATCCAAGAAGCAAATGCAAT 57.274 33.333 8.28 0.00 45.16 3.56
3529 8374 6.127168 TGGACTATTTCTCCTTCGATGCTTTA 60.127 38.462 0.00 0.00 0.00 1.85
3757 8605 3.126831 AGAAGAAGAAATAGATGCGGCG 58.873 45.455 0.51 0.51 0.00 6.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
31 32 7.967854 CGTATGCATTTTCTACCATTTTTCAGA 59.032 33.333 3.54 0.00 0.00 3.27
509 525 4.496336 GGGAGAGGCAGCGGCAAT 62.496 66.667 11.88 0.00 43.71 3.56
647 663 6.228258 TGAGCCTCGTTGTATAAAAGAACTT 58.772 36.000 0.00 0.00 0.00 2.66
1155 1171 7.619698 TCCTAAGAGAACTAGAAATGTCATCCA 59.380 37.037 0.00 0.00 0.00 3.41
1519 6363 3.562182 TCTCACAGCCATATCTTCCGTA 58.438 45.455 0.00 0.00 0.00 4.02
1569 6413 3.312736 GGATTACCATCCCAACACCAT 57.687 47.619 0.00 0.00 43.29 3.55
2892 7737 0.604578 TTCCGGGTCTAACGTGAAGG 59.395 55.000 0.00 0.00 0.00 3.46
3346 8191 4.409718 TCCGGATAATTCACAATTCCGA 57.590 40.909 0.00 0.00 39.35 4.55
3529 8374 5.072872 TCCATTTGTCACCATCCCAATTTTT 59.927 36.000 0.00 0.00 0.00 1.94
3685 8533 5.360714 ACTTCATCAAGCTTGTTTCTTTCCA 59.639 36.000 25.19 3.73 32.09 3.53
3757 8605 0.109597 CACATGCAAAACTCCTCCGC 60.110 55.000 0.00 0.00 0.00 5.54


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.