Multiple sequence alignment - TraesCS5A01G436800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G436800 chr5A 100.000 2162 0 0 1 2162 619265860 619268021 0 3993
1 TraesCS5A01G436800 chr3B 97.921 2165 41 4 1 2162 201526513 201528676 0 3746
2 TraesCS5A01G436800 chr3B 95.465 1279 51 7 887 2162 700786918 700785644 0 2034
3 TraesCS5A01G436800 chr3B 96.696 575 19 0 333 907 810706862 810706288 0 957
4 TraesCS5A01G436800 chr1A 97.829 2165 43 4 1 2162 554511737 554513900 0 3735
5 TraesCS5A01G436800 chr5D 97.783 2165 44 4 1 2162 503217707 503219870 0 3729
6 TraesCS5A01G436800 chr5D 97.552 2165 49 4 1 2162 6188429 6190592 0 3701
7 TraesCS5A01G436800 chr5D 97.502 2162 50 4 4 2162 503278734 503276574 0 3690
8 TraesCS5A01G436800 chr6D 97.737 2165 45 4 1 2162 168254415 168256578 0 3723
9 TraesCS5A01G436800 chr3D 97.595 2162 45 6 4 2162 589280050 589277893 0 3698
10 TraesCS5A01G436800 chr2B 97.090 2165 54 6 1 2162 474907943 474910101 0 3640
11 TraesCS5A01G436800 chr2B 95.211 522 24 1 5 526 700452653 700453173 0 824


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G436800 chr5A 619265860 619268021 2161 False 3993 3993 100.000 1 2162 1 chr5A.!!$F1 2161
1 TraesCS5A01G436800 chr3B 201526513 201528676 2163 False 3746 3746 97.921 1 2162 1 chr3B.!!$F1 2161
2 TraesCS5A01G436800 chr3B 700785644 700786918 1274 True 2034 2034 95.465 887 2162 1 chr3B.!!$R1 1275
3 TraesCS5A01G436800 chr3B 810706288 810706862 574 True 957 957 96.696 333 907 1 chr3B.!!$R2 574
4 TraesCS5A01G436800 chr1A 554511737 554513900 2163 False 3735 3735 97.829 1 2162 1 chr1A.!!$F1 2161
5 TraesCS5A01G436800 chr5D 503217707 503219870 2163 False 3729 3729 97.783 1 2162 1 chr5D.!!$F2 2161
6 TraesCS5A01G436800 chr5D 6188429 6190592 2163 False 3701 3701 97.552 1 2162 1 chr5D.!!$F1 2161
7 TraesCS5A01G436800 chr5D 503276574 503278734 2160 True 3690 3690 97.502 4 2162 1 chr5D.!!$R1 2158
8 TraesCS5A01G436800 chr6D 168254415 168256578 2163 False 3723 3723 97.737 1 2162 1 chr6D.!!$F1 2161
9 TraesCS5A01G436800 chr3D 589277893 589280050 2157 True 3698 3698 97.595 4 2162 1 chr3D.!!$R1 2158
10 TraesCS5A01G436800 chr2B 474907943 474910101 2158 False 3640 3640 97.090 1 2162 1 chr2B.!!$F1 2161
11 TraesCS5A01G436800 chr2B 700452653 700453173 520 False 824 824 95.211 5 526 1 chr2B.!!$F2 521

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
33 34 1.141858 GCTCTAGCTAATTGCCCACCT 59.858 52.381 0.0 0.0 44.23 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1674 1681 2.158623 CCCTGTTAAGCATCCATGGCTA 60.159 50.0 6.96 0.0 41.66 3.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
33 34 1.141858 GCTCTAGCTAATTGCCCACCT 59.858 52.381 0.00 0.00 44.23 4.00
306 308 2.992847 TCCTAGGTCTCTGTGTTCCA 57.007 50.000 9.08 0.00 0.00 3.53
326 328 5.759059 TCCATCATCTGGCTTATGTTCTTT 58.241 37.500 0.00 0.00 45.52 2.52
347 349 9.981114 TTCTTTATGTAGCATTCAGATCGAATA 57.019 29.630 10.91 0.00 42.70 1.75
406 408 4.807783 GGGTAACGTAGGAGACATCCCTG 61.808 56.522 0.00 0.00 42.56 4.45
618 621 1.881973 GAACTCAATCACTTGCTGCCA 59.118 47.619 0.00 0.00 32.11 4.92
627 630 3.689347 TCACTTGCTGCCATTACTCAAT 58.311 40.909 0.00 0.00 0.00 2.57
634 637 6.588719 TGCTGCCATTACTCAATAGTTTTT 57.411 33.333 0.00 0.00 37.15 1.94
680 683 6.070021 AGGTAGTCAAATTGGATCAGTGATCA 60.070 38.462 29.56 14.32 40.50 2.92
966 971 8.437742 CGTCAAAAATCTGTTTTACGGTATAGT 58.562 33.333 0.00 0.00 36.42 2.12
1009 1014 2.024414 GCCTTGCGGTAATGATTCCTT 58.976 47.619 0.00 0.00 0.00 3.36
1088 1093 4.574674 TGGATTTCACTTGCCTGTCTAT 57.425 40.909 0.00 0.00 0.00 1.98
1111 1116 2.669569 CCTTGTGTGTGCTCGGGG 60.670 66.667 0.00 0.00 0.00 5.73
1220 1226 5.607477 GGTTGAAGGGTAATGATCATACGA 58.393 41.667 9.04 0.00 0.00 3.43
1554 1561 6.127925 CCAATTCGTTATGTATGGATGATGGG 60.128 42.308 0.00 0.00 0.00 4.00
1575 1582 4.594920 GGGTGAGATTCCATGGATAGAGAA 59.405 45.833 17.06 0.00 0.00 2.87
1674 1681 1.967779 AGTTGGGCGCTTTAACCATTT 59.032 42.857 7.64 0.00 33.63 2.32
1702 1709 3.459227 TGGATGCTTAACAGGGATCATCA 59.541 43.478 0.00 0.00 34.04 3.07
1813 1820 6.611613 ATGACTATGAAAACACCTCTCTGA 57.388 37.500 0.00 0.00 0.00 3.27
2070 2078 9.107177 GATGTATATTCCTTGCTCATTATCAGG 57.893 37.037 0.00 0.00 0.00 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
33 34 5.147330 ACATAGAAATCACACGTGGAAGA 57.853 39.130 21.57 14.78 0.00 2.87
306 308 9.499479 CTACATAAAGAACATAAGCCAGATGAT 57.501 33.333 0.00 0.00 0.00 2.45
326 328 8.797438 AGAGTTATTCGATCTGAATGCTACATA 58.203 33.333 17.47 0.36 46.72 2.29
347 349 9.448294 GAAGTATCGACGTAATTTCATAGAGTT 57.552 33.333 0.00 0.00 0.00 3.01
634 637 4.901849 CCTCTATGGGATAGACCTCAACAA 59.098 45.833 0.00 0.00 36.98 2.83
952 957 6.142958 GGTCATAAGCGACTATACCGTAAAAC 59.857 42.308 0.00 0.00 36.12 2.43
966 971 0.759436 GAGGGGGAGGTCATAAGCGA 60.759 60.000 0.00 0.00 0.00 4.93
1009 1014 6.459848 CGTTGTGGTAAAGGTTGTAATTCCAA 60.460 38.462 0.00 0.00 0.00 3.53
1111 1116 7.271868 GGCGAAACATTTATACAAAACACCTAC 59.728 37.037 0.00 0.00 0.00 3.18
1183 1189 5.932455 CCCTTCAACCGGGTTATTCTATTA 58.068 41.667 12.95 0.00 36.91 0.98
1220 1226 3.828451 GGGCCATACAATGCATTACAGAT 59.172 43.478 12.53 0.33 0.00 2.90
1554 1561 5.070981 TGGTTCTCTATCCATGGAATCTCAC 59.929 44.000 20.67 11.21 0.00 3.51
1575 1582 6.636454 TTCCATAAGTCTATTGGAACTGGT 57.364 37.500 10.84 0.00 34.16 4.00
1674 1681 2.158623 CCCTGTTAAGCATCCATGGCTA 60.159 50.000 6.96 0.00 41.66 3.93
1789 1796 7.718334 TCAGAGAGGTGTTTTCATAGTCATA 57.282 36.000 0.00 0.00 0.00 2.15
1813 1820 7.334090 TCAATCTCTCTTTCAATTCGAGGATT 58.666 34.615 0.00 0.00 31.22 3.01
2070 2078 4.438744 CGAGGTTTGGGAATAAGTGATTGC 60.439 45.833 0.00 0.00 35.21 3.56


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.