Multiple sequence alignment - TraesCS5A01G420800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G420800 chr5A 100.000 2195 0 0 1 2195 607200940 607198746 0 4054
1 TraesCS5A01G420800 chr5A 90.556 953 62 15 1097 2027 520661594 520662540 0 1236
2 TraesCS5A01G420800 chr1D 96.824 2204 57 11 1 2195 254416215 254418414 0 3670
3 TraesCS5A01G420800 chr5D 96.215 2219 57 14 1 2195 503286451 503288666 0 3607
4 TraesCS5A01G420800 chr5D 95.843 2213 67 16 1 2195 120799021 120801226 0 3554
5 TraesCS5A01G420800 chr5D 95.580 2217 60 23 1 2195 6181793 6179593 0 3517
6 TraesCS5A01G420800 chr5D 95.874 1115 24 9 1102 2195 512409297 512408184 0 1784
7 TraesCS5A01G420800 chr5D 95.792 1117 23 9 1102 2195 512416234 512415119 0 1781
8 TraesCS5A01G420800 chr6D 95.975 2211 61 13 1 2195 45512413 45510215 0 3565
9 TraesCS5A01G420800 chr1A 96.741 2025 50 11 184 2195 554457800 554459821 0 3360
10 TraesCS5A01G420800 chr7B 94.316 2199 112 12 1 2195 105257444 105255255 0 3356
11 TraesCS5A01G420800 chr2A 96.405 1641 44 7 1 1630 335831477 335829841 0 2689
12 TraesCS5A01G420800 chr2A 96.670 1171 30 7 1012 2174 334595896 334594727 0 1938
13 TraesCS5A01G420800 chr2B 96.408 1559 42 10 646 2195 474900137 474901690 0 2556
14 TraesCS5A01G420800 chr4D 92.390 1314 78 15 896 2195 207373081 207374386 0 1853
15 TraesCS5A01G420800 chr4B 93.424 1034 51 10 1172 2195 308683448 308682422 0 1517


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G420800 chr5A 607198746 607200940 2194 True 4054 4054 100.000 1 2195 1 chr5A.!!$R1 2194
1 TraesCS5A01G420800 chr5A 520661594 520662540 946 False 1236 1236 90.556 1097 2027 1 chr5A.!!$F1 930
2 TraesCS5A01G420800 chr1D 254416215 254418414 2199 False 3670 3670 96.824 1 2195 1 chr1D.!!$F1 2194
3 TraesCS5A01G420800 chr5D 503286451 503288666 2215 False 3607 3607 96.215 1 2195 1 chr5D.!!$F2 2194
4 TraesCS5A01G420800 chr5D 120799021 120801226 2205 False 3554 3554 95.843 1 2195 1 chr5D.!!$F1 2194
5 TraesCS5A01G420800 chr5D 6179593 6181793 2200 True 3517 3517 95.580 1 2195 1 chr5D.!!$R1 2194
6 TraesCS5A01G420800 chr5D 512408184 512409297 1113 True 1784 1784 95.874 1102 2195 1 chr5D.!!$R2 1093
7 TraesCS5A01G420800 chr5D 512415119 512416234 1115 True 1781 1781 95.792 1102 2195 1 chr5D.!!$R3 1093
8 TraesCS5A01G420800 chr6D 45510215 45512413 2198 True 3565 3565 95.975 1 2195 1 chr6D.!!$R1 2194
9 TraesCS5A01G420800 chr1A 554457800 554459821 2021 False 3360 3360 96.741 184 2195 1 chr1A.!!$F1 2011
10 TraesCS5A01G420800 chr7B 105255255 105257444 2189 True 3356 3356 94.316 1 2195 1 chr7B.!!$R1 2194
11 TraesCS5A01G420800 chr2A 335829841 335831477 1636 True 2689 2689 96.405 1 1630 1 chr2A.!!$R2 1629
12 TraesCS5A01G420800 chr2A 334594727 334595896 1169 True 1938 1938 96.670 1012 2174 1 chr2A.!!$R1 1162
13 TraesCS5A01G420800 chr2B 474900137 474901690 1553 False 2556 2556 96.408 646 2195 1 chr2B.!!$F1 1549
14 TraesCS5A01G420800 chr4D 207373081 207374386 1305 False 1853 1853 92.390 896 2195 1 chr4D.!!$F1 1299
15 TraesCS5A01G420800 chr4B 308682422 308683448 1026 True 1517 1517 93.424 1172 2195 1 chr4B.!!$R1 1023

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
904 908 3.506398 AGGAGGTATTTTGTGTTTGGGG 58.494 45.455 0.0 0.0 0.0 4.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2075 2126 3.387699 TGATTGTCTCTCGGCCAATATCA 59.612 43.478 2.24 0.0 0.0 2.15 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
90 91 7.808672 TGAAAAAGACGACTAAACAAGTTTGA 58.191 30.769 8.37 0.0 39.07 2.69
127 128 8.713708 TTATTCTTAAATTTCCACCCTCAACA 57.286 30.769 0.00 0.0 0.00 3.33
584 587 5.277825 TGATTTCACCGTTTGTTTCATCAC 58.722 37.500 0.00 0.0 0.00 3.06
691 694 6.370994 TCGGGTTTTATGCGACACTAATAAAA 59.629 34.615 0.00 0.0 34.82 1.52
904 908 3.506398 AGGAGGTATTTTGTGTTTGGGG 58.494 45.455 0.00 0.0 0.00 4.96
1278 1291 5.131784 TGGGTAAAAGCCGAGAAGTTTTAA 58.868 37.500 0.00 0.0 38.98 1.52
1390 1409 1.201429 CCCCTGCACCTAGGTTGAGT 61.201 60.000 13.15 0.0 36.02 3.41
1431 1460 7.299896 ACCTAACAACCTAACCCTATTTTTGT 58.700 34.615 0.00 0.0 0.00 2.83
1901 1946 0.756294 TCTCTCCACGTTCCAAAGCA 59.244 50.000 0.00 0.0 0.00 3.91
1912 1957 3.677424 CGTTCCAAAGCAAAAGGTTTCCA 60.677 43.478 0.00 0.0 0.00 3.53
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
33 34 9.720667 TGTTTCATTCGCATGATAGAATTTTAG 57.279 29.630 0.00 0.00 39.28 1.85
48 49 8.207906 GTCTTTTTCAAACTATGTTTCATTCGC 58.792 33.333 0.00 0.00 0.00 4.70
49 50 8.409690 CGTCTTTTTCAAACTATGTTTCATTCG 58.590 33.333 0.00 0.00 0.00 3.34
127 128 3.833650 AGATTGATCATCTCGAGCCATCT 59.166 43.478 7.81 2.83 37.79 2.90
156 157 9.046846 TGAGGAAGAGTCAATCCTTATTTTCTA 57.953 33.333 16.19 0.00 46.04 2.10
346 348 8.842358 TTTTGGTATTCGAGTTGAAGAAGTAT 57.158 30.769 0.00 0.00 40.65 2.12
584 587 5.835113 ATAATTCCGTCCCAGATTGTTTG 57.165 39.130 0.00 0.00 0.00 2.93
603 606 4.019919 CGTTACTCGGAGGTTCGAATAA 57.980 45.455 10.23 0.00 38.77 1.40
604 607 3.680642 CGTTACTCGGAGGTTCGAATA 57.319 47.619 10.23 0.00 38.77 1.75
1213 1221 4.567971 TGAACACATCATTCAATTTGGCC 58.432 39.130 0.00 0.00 33.16 5.36
1390 1409 7.124147 GGTTGTTAGGTATTGTGTAGGTACCTA 59.876 40.741 18.10 18.10 44.76 3.08
2073 2124 3.904800 TGTCTCTCGGCCAATATCAAA 57.095 42.857 2.24 0.00 0.00 2.69
2075 2126 3.387699 TGATTGTCTCTCGGCCAATATCA 59.612 43.478 2.24 0.00 0.00 2.15


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.