Multiple sequence alignment - TraesCS5A01G420700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G420700 chr5A 100.000 2111 0 0 1 2111 607200355 607198245 0.000000e+00 3899.0
1 TraesCS5A01G420700 chr1D 96.797 2123 52 14 1 2111 254416800 254418918 0.000000e+00 3530.0
2 TraesCS5A01G420700 chr1D 95.917 2131 64 12 1 2111 51878338 51876211 0.000000e+00 3432.0
3 TraesCS5A01G420700 chr1A 96.527 2131 51 17 1 2111 554458202 554460329 0.000000e+00 3504.0
4 TraesCS5A01G420700 chr6D 96.341 2132 51 18 1 2111 45511836 45509711 0.000000e+00 3480.0
5 TraesCS5A01G420700 chr5D 96.077 2141 52 16 1 2111 503287035 503289173 0.000000e+00 3459.0
6 TraesCS5A01G420700 chr5D 95.202 2126 77 13 1 2111 167071669 167073784 0.000000e+00 3338.0
7 TraesCS5A01G420700 chr2B 96.749 2061 51 12 61 2111 474900137 474902191 0.000000e+00 3421.0
8 TraesCS5A01G420700 chr7B 94.747 2113 95 15 1 2106 105256860 105254757 0.000000e+00 3273.0
9 TraesCS5A01G420700 chr2D 96.193 1970 39 15 166 2111 9785044 9787001 0.000000e+00 3190.0
10 TraesCS5A01G420700 chr4B 93.819 1537 70 15 587 2111 308683448 308681925 0.000000e+00 2289.0
11 TraesCS5A01G420700 chr2A 96.023 1056 27 7 1 1045 335830892 335829841 0.000000e+00 1703.0
12 TraesCS5A01G420700 chr3B 97.247 799 21 1 1 798 101919310 101918512 0.000000e+00 1352.0
13 TraesCS5A01G420700 chr3B 90.210 143 11 1 1 143 20301311 20301172 1.290000e-42 183.0
14 TraesCS5A01G420700 chr3B 85.185 54 8 0 1 54 227107818 227107871 2.930000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G420700 chr5A 607198245 607200355 2110 True 3899 3899 100.000 1 2111 1 chr5A.!!$R1 2110
1 TraesCS5A01G420700 chr1D 254416800 254418918 2118 False 3530 3530 96.797 1 2111 1 chr1D.!!$F1 2110
2 TraesCS5A01G420700 chr1D 51876211 51878338 2127 True 3432 3432 95.917 1 2111 1 chr1D.!!$R1 2110
3 TraesCS5A01G420700 chr1A 554458202 554460329 2127 False 3504 3504 96.527 1 2111 1 chr1A.!!$F1 2110
4 TraesCS5A01G420700 chr6D 45509711 45511836 2125 True 3480 3480 96.341 1 2111 1 chr6D.!!$R1 2110
5 TraesCS5A01G420700 chr5D 503287035 503289173 2138 False 3459 3459 96.077 1 2111 1 chr5D.!!$F2 2110
6 TraesCS5A01G420700 chr5D 167071669 167073784 2115 False 3338 3338 95.202 1 2111 1 chr5D.!!$F1 2110
7 TraesCS5A01G420700 chr2B 474900137 474902191 2054 False 3421 3421 96.749 61 2111 1 chr2B.!!$F1 2050
8 TraesCS5A01G420700 chr7B 105254757 105256860 2103 True 3273 3273 94.747 1 2106 1 chr7B.!!$R1 2105
9 TraesCS5A01G420700 chr2D 9785044 9787001 1957 False 3190 3190 96.193 166 2111 1 chr2D.!!$F1 1945
10 TraesCS5A01G420700 chr4B 308681925 308683448 1523 True 2289 2289 93.819 587 2111 1 chr4B.!!$R1 1524
11 TraesCS5A01G420700 chr2A 335829841 335830892 1051 True 1703 1703 96.023 1 1045 1 chr2A.!!$R1 1044
12 TraesCS5A01G420700 chr3B 101918512 101919310 798 True 1352 1352 97.247 1 798 1 chr3B.!!$R2 797

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
319 320 3.506398 AGGAGGTATTTTGTGTTTGGGG 58.494 45.455 0.0 0.0 0.0 4.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1925 1980 3.181436 CCTCTCTATTGCATGGGTGGAAT 60.181 47.826 0.0 1.04 46.42 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
106 107 6.370994 TCGGGTTTTATGCGACACTAATAAAA 59.629 34.615 0.0 0.0 34.82 1.52
319 320 3.506398 AGGAGGTATTTTGTGTTTGGGG 58.494 45.455 0.0 0.0 0.00 4.96
613 618 8.094798 AGCTGTTGTAAGTTTTCGATGAAATA 57.905 30.769 0.0 0.0 31.34 1.40
693 699 5.131784 TGGGTAAAAGCCGAGAAGTTTTAA 58.868 37.500 0.0 0.0 38.98 1.52
846 862 7.299896 ACCTAACAACCTAACCCTATTTTTGT 58.700 34.615 0.0 0.0 0.00 2.83
1236 1266 3.054065 AGCGGAAAGAGAGGGATTCAAAT 60.054 43.478 0.0 0.0 0.00 2.32
1316 1347 0.756294 TCTCTCCACGTTCCAAAGCA 59.244 50.000 0.0 0.0 0.00 3.91
1327 1358 3.677424 CGTTCCAAAGCAAAAGGTTTCCA 60.677 43.478 0.0 0.0 0.00 3.53
1781 1824 6.534475 TTATTTCCTTAGACTTAGACCGCA 57.466 37.500 0.0 0.0 0.00 5.69
1974 2029 6.964807 TGGGAAAAGAAGGGTTACTTTTAC 57.035 37.500 0.0 0.0 43.36 2.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 19 4.019919 CGTTACTCGGAGGTTCGAATAA 57.980 45.455 10.23 0.00 38.77 1.40
19 20 3.680642 CGTTACTCGGAGGTTCGAATA 57.319 47.619 10.23 0.00 38.77 1.75
613 618 7.630082 TCAATTTGGCCTACAGAGTACTAAAT 58.370 34.615 3.32 0.00 0.00 1.40
628 633 4.567971 TGAACACATCATTCAATTTGGCC 58.432 39.130 0.00 0.00 33.16 5.36
1488 1526 3.904800 TGTCTCTCGGCCAATATCAAA 57.095 42.857 2.24 0.00 0.00 2.69
1490 1528 3.387699 TGATTGTCTCTCGGCCAATATCA 59.612 43.478 2.24 0.00 0.00 2.15
1781 1824 9.394477 GTAAATAGCGAAAAATTCTTGTCTTGT 57.606 29.630 0.00 0.00 0.00 3.16
1913 1968 6.040391 TGCATGGGTGGAATAACTAAAATAGC 59.960 38.462 0.00 0.00 0.00 2.97
1925 1980 3.181436 CCTCTCTATTGCATGGGTGGAAT 60.181 47.826 0.00 1.04 46.42 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.