Multiple sequence alignment - TraesCS5A01G415800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G415800 chr5A 100.000 2291 0 0 1 2291 604994778 604997068 0 4231
1 TraesCS5A01G415800 chr5A 98.818 592 7 0 1700 2291 411493294 411493885 0 1055
2 TraesCS5A01G415800 chr5A 98.649 592 8 0 1700 2291 416137127 416136536 0 1050
3 TraesCS5A01G415800 chr5B 99.000 1700 16 1 1 1699 695890926 695892625 0 3044
4 TraesCS5A01G415800 chr5B 98.471 1700 24 2 1 1699 127827340 127825642 0 2994
5 TraesCS5A01G415800 chrUn 98.941 1700 17 1 1 1699 246705339 246703640 0 3038
6 TraesCS5A01G415800 chrUn 98.824 1700 19 1 1 1699 266185496 266183797 0 3027
7 TraesCS5A01G415800 chrUn 98.930 1683 17 1 1 1682 206792695 206791013 0 3007
8 TraesCS5A01G415800 chr7A 98.941 1700 17 1 1 1699 200015317 200013618 0 3038
9 TraesCS5A01G415800 chr7A 98.649 592 8 0 1700 2291 31827169 31826578 0 1050
10 TraesCS5A01G415800 chr7B 98.882 1700 18 1 1 1699 742929142 742930841 0 3033
11 TraesCS5A01G415800 chr7B 98.412 1700 25 2 1 1699 698134953 698133255 0 2988
12 TraesCS5A01G415800 chr6B 98.529 1700 24 1 1 1699 128898326 128896627 0 3000
13 TraesCS5A01G415800 chr4A 98.818 592 7 0 1700 2291 518146507 518147098 0 1055
14 TraesCS5A01G415800 chr2A 98.820 593 6 1 1700 2291 39194272 39193680 0 1055
15 TraesCS5A01G415800 chr3A 98.649 592 8 0 1700 2291 668254385 668253794 0 1050
16 TraesCS5A01G415800 chr1A 98.649 592 8 0 1700 2291 588962304 588962895 0 1050
17 TraesCS5A01G415800 chr6A 98.480 592 9 0 1700 2291 131403337 131403928 0 1044
18 TraesCS5A01G415800 chr6A 98.482 593 8 1 1700 2291 616372174 616371582 0 1044


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G415800 chr5A 604994778 604997068 2290 False 4231 4231 100.000 1 2291 1 chr5A.!!$F2 2290
1 TraesCS5A01G415800 chr5A 411493294 411493885 591 False 1055 1055 98.818 1700 2291 1 chr5A.!!$F1 591
2 TraesCS5A01G415800 chr5A 416136536 416137127 591 True 1050 1050 98.649 1700 2291 1 chr5A.!!$R1 591
3 TraesCS5A01G415800 chr5B 695890926 695892625 1699 False 3044 3044 99.000 1 1699 1 chr5B.!!$F1 1698
4 TraesCS5A01G415800 chr5B 127825642 127827340 1698 True 2994 2994 98.471 1 1699 1 chr5B.!!$R1 1698
5 TraesCS5A01G415800 chrUn 246703640 246705339 1699 True 3038 3038 98.941 1 1699 1 chrUn.!!$R2 1698
6 TraesCS5A01G415800 chrUn 266183797 266185496 1699 True 3027 3027 98.824 1 1699 1 chrUn.!!$R3 1698
7 TraesCS5A01G415800 chrUn 206791013 206792695 1682 True 3007 3007 98.930 1 1682 1 chrUn.!!$R1 1681
8 TraesCS5A01G415800 chr7A 200013618 200015317 1699 True 3038 3038 98.941 1 1699 1 chr7A.!!$R2 1698
9 TraesCS5A01G415800 chr7A 31826578 31827169 591 True 1050 1050 98.649 1700 2291 1 chr7A.!!$R1 591
10 TraesCS5A01G415800 chr7B 742929142 742930841 1699 False 3033 3033 98.882 1 1699 1 chr7B.!!$F1 1698
11 TraesCS5A01G415800 chr7B 698133255 698134953 1698 True 2988 2988 98.412 1 1699 1 chr7B.!!$R1 1698
12 TraesCS5A01G415800 chr6B 128896627 128898326 1699 True 3000 3000 98.529 1 1699 1 chr6B.!!$R1 1698
13 TraesCS5A01G415800 chr4A 518146507 518147098 591 False 1055 1055 98.818 1700 2291 1 chr4A.!!$F1 591
14 TraesCS5A01G415800 chr2A 39193680 39194272 592 True 1055 1055 98.820 1700 2291 1 chr2A.!!$R1 591
15 TraesCS5A01G415800 chr3A 668253794 668254385 591 True 1050 1050 98.649 1700 2291 1 chr3A.!!$R1 591
16 TraesCS5A01G415800 chr1A 588962304 588962895 591 False 1050 1050 98.649 1700 2291 1 chr1A.!!$F1 591
17 TraesCS5A01G415800 chr6A 131403337 131403928 591 False 1044 1044 98.480 1700 2291 1 chr6A.!!$F1 591
18 TraesCS5A01G415800 chr6A 616371582 616372174 592 True 1044 1044 98.482 1700 2291 1 chr6A.!!$R1 591

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
703 704 1.999648 TTTCATGCAAGCCTGACCTT 58.0 45.0 0.0 0.0 0.0 3.5 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1966 1968 3.602483 TCTTACCTACGCATCAAAACCC 58.398 45.455 0.0 0.0 0.0 4.11 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
388 389 6.062258 AGACTATTGCCTTTTTAGCCTACA 57.938 37.500 0.00 0.00 0.00 2.74
652 653 3.072622 GTCCCTCAGTTCTTACCAACCTT 59.927 47.826 0.00 0.00 0.00 3.50
703 704 1.999648 TTTCATGCAAGCCTGACCTT 58.000 45.000 0.00 0.00 0.00 3.50
857 858 5.587388 ACTTATCCGAACCGAACATTAGA 57.413 39.130 0.00 0.00 0.00 2.10
941 942 2.582636 AGTATGGGGCAAAGGATCAAGT 59.417 45.455 0.00 0.00 0.00 3.16
1055 1056 0.179111 TATGTAGTCTGCGCTGGTGC 60.179 55.000 14.70 6.58 0.00 5.01
1204 1206 0.669625 ACCTACGAAACTCGCCTTGC 60.670 55.000 0.00 0.00 45.12 4.01
1308 1310 5.675444 CGACTAAAACGAAAACAAGACAAGG 59.325 40.000 0.00 0.00 0.00 3.61
1473 1475 0.882927 CGACCGGGAGAAGCAAAACA 60.883 55.000 6.32 0.00 0.00 2.83
1966 1968 4.783242 CCAACTTGACAAACTATCGTTGG 58.217 43.478 16.04 16.04 42.42 3.77
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
566 567 6.091713 GCTACTTAATCGTAGGTTTGCTTTCA 59.908 38.462 4.57 0.0 37.83 2.69
703 704 7.500227 CCTGAATGAATAAGAAATGGACAGCTA 59.500 37.037 0.00 0.0 0.00 3.32
941 942 2.159114 GGGACAAAGCAAAGTCAAAGCA 60.159 45.455 5.09 0.0 36.50 3.91
1204 1206 0.886563 ACACCTACCGAGACGAAAGG 59.113 55.000 0.00 0.0 35.66 3.11
1308 1310 3.698040 TCCTGTAGTACGGGTCTTGATTC 59.302 47.826 24.59 0.0 45.01 2.52
1966 1968 3.602483 TCTTACCTACGCATCAAAACCC 58.398 45.455 0.00 0.0 0.00 4.11


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.