Multiple sequence alignment - TraesCS5A01G412600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G412600 chr5A 100.000 2530 0 0 1 2530 601234482 601237011 0.000000e+00 4673
1 TraesCS5A01G412600 chr6A 98.895 2534 23 4 1 2530 555577007 555579539 0.000000e+00 4519
2 TraesCS5A01G412600 chr1B 95.657 2510 88 16 36 2530 339081695 339079192 0.000000e+00 4012
3 TraesCS5A01G412600 chr1B 96.450 1155 35 6 1381 2530 338888079 338886926 0.000000e+00 1901
4 TraesCS5A01G412600 chr1B 91.541 331 23 3 2204 2529 427603389 427603719 3.840000e-123 451
5 TraesCS5A01G412600 chr6D 95.571 1332 44 10 36 1357 336840316 336838990 0.000000e+00 2119
6 TraesCS5A01G412600 chr6D 95.177 1161 42 11 1374 2530 336838794 336837644 0.000000e+00 1821
7 TraesCS5A01G412600 chr2B 94.899 1333 52 10 36 1357 789006302 789007629 0.000000e+00 2071
8 TraesCS5A01G412600 chr2B 94.845 1164 48 9 1371 2530 789007823 789008978 0.000000e+00 1807
9 TraesCS5A01G412600 chr2B 80.589 747 92 21 618 1340 795844935 795845652 6.200000e-146 527
10 TraesCS5A01G412600 chr2B 82.941 340 42 11 2203 2530 153586480 153586815 2.460000e-75 292
11 TraesCS5A01G412600 chr6B 96.138 1217 41 6 1319 2530 42821559 42820344 0.000000e+00 1982
12 TraesCS5A01G412600 chr6B 94.149 1299 60 11 36 1324 42829261 42827969 0.000000e+00 1964
13 TraesCS5A01G412600 chr6B 82.824 425 33 18 442 863 123379824 123380211 6.700000e-91 344
14 TraesCS5A01G412600 chrUn 100.000 394 0 0 1803 2196 479457427 479457034 0.000000e+00 728
15 TraesCS5A01G412600 chr5D 87.542 602 56 9 700 1294 453854553 453853964 0.000000e+00 678
16 TraesCS5A01G412600 chr5D 88.000 175 21 0 442 616 453854723 453854549 9.170000e-50 207
17 TraesCS5A01G412600 chr7A 87.151 537 35 11 551 1077 39209460 39209972 1.690000e-161 579
18 TraesCS5A01G412600 chr7A 85.488 441 50 9 1710 2139 476915092 476915529 4.960000e-122 448
19 TraesCS5A01G412600 chr7A 89.492 295 28 1 1420 1714 476914736 476915027 1.110000e-98 370
20 TraesCS5A01G412600 chr7B 80.882 748 90 22 618 1340 662233632 662232913 7.960000e-150 540
21 TraesCS5A01G412600 chr7B 80.080 748 92 22 618 1340 458529572 458530287 1.040000e-138 503
22 TraesCS5A01G412600 chr7B 85.327 443 50 9 1710 2139 428828814 428829254 6.420000e-121 444
23 TraesCS5A01G412600 chr7B 89.189 296 27 3 1420 1714 428828458 428828749 5.140000e-97 364
24 TraesCS5A01G412600 chr7D 90.169 295 26 1 1420 1714 414276647 414276938 5.110000e-102 381
25 TraesCS5A01G412600 chr7D 90.244 82 8 0 1342 1423 104549077 104549158 9.570000e-20 108
26 TraesCS5A01G412600 chr2D 84.659 352 30 8 2203 2530 102280053 102280404 1.880000e-86 329
27 TraesCS5A01G412600 chr3B 90.090 222 19 3 41 262 312484417 312484635 4.120000e-73 285
28 TraesCS5A01G412600 chr3B 89.157 83 8 1 2064 2146 573309972 573310053 4.450000e-18 102
29 TraesCS5A01G412600 chr3B 89.024 82 6 2 97 178 312484394 312484472 5.760000e-17 99
30 TraesCS5A01G412600 chr2A 81.250 352 38 15 2203 2530 101378234 101378581 2.500000e-65 259
31 TraesCS5A01G412600 chr3A 89.349 169 18 0 260 428 649853001 649853169 1.970000e-51 213
32 TraesCS5A01G412600 chr3A 90.244 82 8 0 1342 1423 477794110 477794191 9.570000e-20 108
33 TraesCS5A01G412600 chr4D 91.250 80 7 0 1342 1421 477972850 477972771 2.660000e-20 110


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G412600 chr5A 601234482 601237011 2529 False 4673.0 4673 100.000 1 2530 1 chr5A.!!$F1 2529
1 TraesCS5A01G412600 chr6A 555577007 555579539 2532 False 4519.0 4519 98.895 1 2530 1 chr6A.!!$F1 2529
2 TraesCS5A01G412600 chr1B 339079192 339081695 2503 True 4012.0 4012 95.657 36 2530 1 chr1B.!!$R2 2494
3 TraesCS5A01G412600 chr1B 338886926 338888079 1153 True 1901.0 1901 96.450 1381 2530 1 chr1B.!!$R1 1149
4 TraesCS5A01G412600 chr6D 336837644 336840316 2672 True 1970.0 2119 95.374 36 2530 2 chr6D.!!$R1 2494
5 TraesCS5A01G412600 chr2B 789006302 789008978 2676 False 1939.0 2071 94.872 36 2530 2 chr2B.!!$F3 2494
6 TraesCS5A01G412600 chr2B 795844935 795845652 717 False 527.0 527 80.589 618 1340 1 chr2B.!!$F2 722
7 TraesCS5A01G412600 chr6B 42820344 42821559 1215 True 1982.0 1982 96.138 1319 2530 1 chr6B.!!$R1 1211
8 TraesCS5A01G412600 chr6B 42827969 42829261 1292 True 1964.0 1964 94.149 36 1324 1 chr6B.!!$R2 1288
9 TraesCS5A01G412600 chr5D 453853964 453854723 759 True 442.5 678 87.771 442 1294 2 chr5D.!!$R1 852
10 TraesCS5A01G412600 chr7A 39209460 39209972 512 False 579.0 579 87.151 551 1077 1 chr7A.!!$F1 526
11 TraesCS5A01G412600 chr7A 476914736 476915529 793 False 409.0 448 87.490 1420 2139 2 chr7A.!!$F2 719
12 TraesCS5A01G412600 chr7B 662232913 662233632 719 True 540.0 540 80.882 618 1340 1 chr7B.!!$R1 722
13 TraesCS5A01G412600 chr7B 458529572 458530287 715 False 503.0 503 80.080 618 1340 1 chr7B.!!$F1 722
14 TraesCS5A01G412600 chr7B 428828458 428829254 796 False 404.0 444 87.258 1420 2139 2 chr7B.!!$F2 719

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
486 488 0.664761 GACACAAGCAGAGCAAAGCA 59.335 50.0 0.0 0.0 0.0 3.91 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1801 2082 2.414806 CATCCAGAGATCATTGCTCCG 58.585 52.381 0.0 0.0 32.82 4.63 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
290 292 5.813672 GCAGTGTAGTAATGTTATTCCGGAA 59.186 40.000 21.37 21.37 0.00 4.30
367 369 2.237143 CTGGCTGGTTTCTGATCCACTA 59.763 50.000 0.00 0.00 0.00 2.74
486 488 0.664761 GACACAAGCAGAGCAAAGCA 59.335 50.000 0.00 0.00 0.00 3.91
914 931 3.059188 GTGGTTAACTGTGGTCACAATCG 60.059 47.826 5.42 0.00 41.33 3.34
1205 1231 7.473735 TGTATCATCTGGTTCTATGGAGATC 57.526 40.000 0.00 0.00 0.00 2.75
1801 2082 9.533253 CAATTTACTTGAATATCATTGGTTCCC 57.467 33.333 0.00 0.00 36.97 3.97
2196 2490 4.329545 GGTTCCCAGCCGAGCACA 62.330 66.667 0.00 0.00 0.00 4.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
65 66 2.610232 CCACACCTAAAATTGGCACTGC 60.610 50.000 0.00 0.0 0.00 4.40
290 292 7.319646 TCCTTTTATTTTGTAAATCGCATGCT 58.680 30.769 17.13 0.0 0.00 3.79
334 336 0.625849 CCAGCCAGTCCCTTAACCAT 59.374 55.000 0.00 0.0 0.00 3.55
367 369 6.480981 CCTTCACAAAAGAATGCTCAATTTGT 59.519 34.615 0.00 0.0 41.09 2.83
975 994 0.321210 CGTACAGCCCACATCCAACA 60.321 55.000 0.00 0.0 0.00 3.33
1192 1218 3.198853 GGCCATAGGGATCTCCATAGAAC 59.801 52.174 0.00 0.0 35.57 3.01
1205 1231 5.126061 GCATTTATTCACATAGGCCATAGGG 59.874 44.000 5.01 0.0 37.18 3.53
1297 1328 7.969690 ACACCCATGTGAATCCATTAAAATA 57.030 32.000 0.00 0.0 45.76 1.40
1801 2082 2.414806 CATCCAGAGATCATTGCTCCG 58.585 52.381 0.00 0.0 32.82 4.63


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.