Multiple sequence alignment - TraesCS5A01G410700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G410700 chr5A 100.000 3475 0 0 1 3475 599649720 599653194 0.000000e+00 6418.0
1 TraesCS5A01G410700 chr5A 95.928 663 25 2 957 1618 483709523 483708862 0.000000e+00 1074.0
2 TraesCS5A01G410700 chr5A 95.585 521 20 1 1812 2329 483708346 483707826 0.000000e+00 832.0
3 TraesCS5A01G410700 chr5A 87.052 726 76 10 203 913 143655907 143655185 0.000000e+00 804.0
4 TraesCS5A01G410700 chr5A 83.529 340 38 7 581 911 534531446 534531116 5.640000e-78 302.0
5 TraesCS5A01G410700 chr5A 84.516 155 15 6 3322 3475 119071159 119071305 1.010000e-30 145.0
6 TraesCS5A01G410700 chr4A 99.082 3485 17 4 1 3475 662459272 662455793 0.000000e+00 6244.0
7 TraesCS5A01G410700 chr4A 96.838 2688 81 1 1 2688 106086821 106089504 0.000000e+00 4490.0
8 TraesCS5A01G410700 chr4A 96.287 808 27 3 2669 3475 106089699 106090504 0.000000e+00 1323.0
9 TraesCS5A01G410700 chr4A 85.714 77 10 1 3399 3474 738369660 738369736 2.880000e-11 80.5
10 TraesCS5A01G410700 chr1B 99.075 3351 20 2 1 3341 588477682 588474333 0.000000e+00 6006.0
11 TraesCS5A01G410700 chr1B 98.182 110 2 0 3366 3475 588473914 588473805 3.540000e-45 193.0
12 TraesCS5A01G410700 chr5B 96.531 663 21 2 957 1618 459479911 459479250 0.000000e+00 1096.0
13 TraesCS5A01G410700 chr5B 95.358 517 21 1 1816 2329 459478733 459478217 0.000000e+00 819.0
14 TraesCS5A01G410700 chr5B 94.068 118 7 0 3358 3475 257027230 257027347 2.760000e-41 180.0
15 TraesCS5A01G410700 chr5D 96.229 663 23 2 957 1618 383635474 383634813 0.000000e+00 1085.0
16 TraesCS5A01G410700 chr5D 95.393 521 21 1 1812 2329 383634293 383633773 0.000000e+00 826.0
17 TraesCS5A01G410700 chr5D 96.133 181 6 1 1632 1812 383634501 383634322 9.430000e-76 294.0
18 TraesCS5A01G410700 chr5D 86.099 223 25 4 1145 1366 538563423 538563640 5.800000e-58 235.0
19 TraesCS5A01G410700 chr6B 81.912 1161 133 37 2360 3475 247040430 247039302 0.000000e+00 909.0
20 TraesCS5A01G410700 chr6B 88.372 516 36 9 416 913 247041331 247040822 1.780000e-167 599.0
21 TraesCS5A01G410700 chr2A 80.760 842 108 31 2667 3475 363368040 363368860 2.970000e-170 608.0
22 TraesCS5A01G410700 chr2A 87.719 513 42 11 416 913 363366122 363366628 2.330000e-161 579.0
23 TraesCS5A01G410700 chr2A 88.814 295 25 4 2667 2959 6470872 6471160 4.270000e-94 355.0
24 TraesCS5A01G410700 chr2A 86.667 180 18 4 3291 3470 6471332 6471505 9.840000e-46 195.0
25 TraesCS5A01G410700 chr2A 83.146 178 28 2 2414 2589 363367833 363368010 9.980000e-36 161.0
26 TraesCS5A01G410700 chr3B 83.886 664 67 15 2404 3042 685076689 685076041 6.420000e-167 597.0
27 TraesCS5A01G410700 chr3B 99.524 210 1 0 1211 1420 793123140 793123349 1.960000e-102 383.0
28 TraesCS5A01G410700 chr3D 82.987 529 59 14 2360 2869 32173936 32174452 1.900000e-122 449.0
29 TraesCS5A01G410700 chr3D 92.715 151 11 0 51 201 138218131 138217981 5.840000e-53 219.0
30 TraesCS5A01G410700 chr3D 82.184 174 18 5 2879 3039 32176796 32176969 1.680000e-28 137.0
31 TraesCS5A01G410700 chr3D 87.500 72 8 1 3405 3475 568930106 568930035 7.990000e-12 82.4
32 TraesCS5A01G410700 chr2B 88.473 347 29 6 202 547 445897168 445897504 3.230000e-110 409.0
33 TraesCS5A01G410700 chr2B 93.023 43 3 0 3380 3422 4928061 4928103 2.900000e-06 63.9
34 TraesCS5A01G410700 chr7D 84.539 401 43 6 533 921 484185154 484184761 2.530000e-101 379.0
35 TraesCS5A01G410700 chr6D 85.946 185 19 5 1632 1810 466790725 466790908 1.270000e-44 191.0
36 TraesCS5A01G410700 chr7B 93.590 78 5 0 4 81 49418522 49418445 2.190000e-22 117.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G410700 chr5A 599649720 599653194 3474 False 6418.000000 6418 100.000000 1 3475 1 chr5A.!!$F2 3474
1 TraesCS5A01G410700 chr5A 483707826 483709523 1697 True 953.000000 1074 95.756500 957 2329 2 chr5A.!!$R3 1372
2 TraesCS5A01G410700 chr5A 143655185 143655907 722 True 804.000000 804 87.052000 203 913 1 chr5A.!!$R1 710
3 TraesCS5A01G410700 chr4A 662455793 662459272 3479 True 6244.000000 6244 99.082000 1 3475 1 chr4A.!!$R1 3474
4 TraesCS5A01G410700 chr4A 106086821 106090504 3683 False 2906.500000 4490 96.562500 1 3475 2 chr4A.!!$F2 3474
5 TraesCS5A01G410700 chr1B 588473805 588477682 3877 True 3099.500000 6006 98.628500 1 3475 2 chr1B.!!$R1 3474
6 TraesCS5A01G410700 chr5B 459478217 459479911 1694 True 957.500000 1096 95.944500 957 2329 2 chr5B.!!$R1 1372
7 TraesCS5A01G410700 chr5D 383633773 383635474 1701 True 735.000000 1085 95.918333 957 2329 3 chr5D.!!$R1 1372
8 TraesCS5A01G410700 chr6B 247039302 247041331 2029 True 754.000000 909 85.142000 416 3475 2 chr6B.!!$R1 3059
9 TraesCS5A01G410700 chr2A 363366122 363368860 2738 False 449.333333 608 83.875000 416 3475 3 chr2A.!!$F2 3059
10 TraesCS5A01G410700 chr2A 6470872 6471505 633 False 275.000000 355 87.740500 2667 3470 2 chr2A.!!$F1 803
11 TraesCS5A01G410700 chr3B 685076041 685076689 648 True 597.000000 597 83.886000 2404 3042 1 chr3B.!!$R1 638
12 TraesCS5A01G410700 chr3D 32173936 32176969 3033 False 293.000000 449 82.585500 2360 3039 2 chr3D.!!$F1 679

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
369 380 1.017177 TAACGACGTTGGATGGCTGC 61.017 55.0 23.0 0.0 0.0 5.25 F
917 948 5.103940 ACATGGGGAAGCAGATAACAGTAAT 60.104 40.0 0.0 0.0 0.0 1.89 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2357 3134 3.629398 CAGACAATGGAAAGATGCTACCC 59.371 47.826 0.00 0.0 0.00 3.69 R
2589 3390 0.893447 GGTACTCCGTACAAGCCTGT 59.107 55.000 6.51 0.0 40.41 4.00 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
77 78 2.006888 GTGCTTTGGCGCTCTGTATTA 58.993 47.619 7.64 0.00 44.66 0.98
369 380 1.017177 TAACGACGTTGGATGGCTGC 61.017 55.000 23.00 0.00 0.00 5.25
917 948 5.103940 ACATGGGGAAGCAGATAACAGTAAT 60.104 40.000 0.00 0.00 0.00 1.89
1148 1440 5.485708 AGTCTCTTAAGCACAAGGTAAGGAT 59.514 40.000 0.00 0.00 0.00 3.24
2144 2803 5.447010 GCTGCACAATCACTCTCTAATCAAC 60.447 44.000 0.00 0.00 0.00 3.18
2296 3054 5.534278 TGCTTTGTGAACAGATATCCAACAA 59.466 36.000 0.00 1.23 0.00 2.83
2357 3134 1.939934 TGTTGTGGAAGAGTTCTTGCG 59.060 47.619 8.54 0.00 45.69 4.85
2511 3310 3.448301 CAGGAATTATTCTTTGCTGGCCA 59.552 43.478 4.71 4.71 38.45 5.36
2589 3390 5.842328 TCTTCCAGTTTTAGGTACTCTCCAA 59.158 40.000 0.00 0.00 41.75 3.53
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
917 948 4.263462 ACCATAGTCATCTTGCTTGGTTCA 60.263 41.667 0.00 0.00 32.23 3.18
1148 1440 2.165234 CTCTGCTTCTCCGAGAATGACA 59.835 50.000 11.29 9.24 33.13 3.58
2357 3134 3.629398 CAGACAATGGAAAGATGCTACCC 59.371 47.826 0.00 0.00 0.00 3.69
2511 3310 1.915078 AAGCAGCGCCTCCACCTTAT 61.915 55.000 2.29 0.00 0.00 1.73
2589 3390 0.893447 GGTACTCCGTACAAGCCTGT 59.107 55.000 6.51 0.00 40.41 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.