Multiple sequence alignment - TraesCS5A01G399300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G399300 chr5A 100.000 1611 0 0 1 1611 593036562 593034952 0.000000e+00 2976
1 TraesCS5A01G399300 chr5A 99.182 1589 13 0 1 1589 592832978 592834566 0.000000e+00 2863
2 TraesCS5A01G399300 chr5A 88.581 902 90 8 4 902 593055399 593054508 0.000000e+00 1083
3 TraesCS5A01G399300 chr5A 100.000 485 0 0 1828 2312 593034735 593034251 0.000000e+00 896
4 TraesCS5A01G399300 chr5A 99.147 469 4 0 1844 2312 592834783 592835251 0.000000e+00 845
5 TraesCS5A01G399300 chr5A 91.529 484 40 1 1828 2311 592836922 592837404 0.000000e+00 665
6 TraesCS5A01G399300 chr5A 84.087 641 69 20 272 903 592691273 592690657 2.560000e-164 588
7 TraesCS5A01G399300 chr5A 97.353 340 8 1 1272 1611 592836578 592836916 5.540000e-161 577
8 TraesCS5A01G399300 chr5A 89.640 222 22 1 2089 2310 592837670 592837890 4.860000e-72 281
9 TraesCS5A01G399300 chr5A 87.079 178 16 1 812 982 592837471 592837648 6.520000e-46 195
10 TraesCS5A01G399300 chr5D 94.379 1619 80 3 1 1611 473052682 473051067 0.000000e+00 2475
11 TraesCS5A01G399300 chr5D 90.836 873 61 12 3 857 473041333 473040462 0.000000e+00 1151
12 TraesCS5A01G399300 chr5D 89.480 903 89 5 2 902 473064267 473063369 0.000000e+00 1136
13 TraesCS5A01G399300 chr5D 94.398 482 24 3 1832 2312 473050099 473049620 0.000000e+00 737
14 TraesCS5A01G399300 chr5D 93.621 486 28 3 1828 2312 473051061 473050578 0.000000e+00 723
15 TraesCS5A01G399300 chr5D 93.850 439 23 4 993 1428 503330965 503330528 0.000000e+00 658
16 TraesCS5A01G399300 chr5D 94.009 434 24 2 993 1425 6235847 6236279 0.000000e+00 656
17 TraesCS5A01G399300 chr5D 91.964 224 16 2 2089 2312 473063341 473063120 1.720000e-81 313
18 TraesCS5A01G399300 chr5D 83.742 326 44 7 536 857 473039027 473038707 1.340000e-77 300
19 TraesCS5A01G399300 chr5B 91.429 875 56 12 1 857 580426889 580426016 0.000000e+00 1182
20 TraesCS5A01G399300 chr5B 89.480 903 92 3 2 903 580431350 580430450 0.000000e+00 1138
21 TraesCS5A01G399300 chr5B 80.370 270 46 4 441 706 580424959 580424693 5.040000e-47 198
22 TraesCS5A01G399300 chr1A 94.253 435 22 3 993 1425 554447892 554448325 0.000000e+00 662
23 TraesCS5A01G399300 chrUn 94.037 436 22 4 993 1425 426380331 426380765 0.000000e+00 658
24 TraesCS5A01G399300 chr2D 94.037 436 22 4 993 1425 648663249 648663683 0.000000e+00 658
25 TraesCS5A01G399300 chr2D 97.906 191 4 0 1419 1609 591991006 591990816 4.760000e-87 331
26 TraesCS5A01G399300 chr1D 93.850 439 23 4 993 1428 254477052 254476615 0.000000e+00 658
27 TraesCS5A01G399300 chr1D 95.817 263 11 0 1828 2090 254530742 254530480 2.120000e-115 425
28 TraesCS5A01G399300 chr3B 93.166 439 26 3 993 1428 201493057 201492620 1.940000e-180 641
29 TraesCS5A01G399300 chr7B 96.198 263 10 0 1828 2090 663094290 663094552 4.560000e-117 431
30 TraesCS5A01G399300 chr7B 95.817 263 11 0 1828 2090 622424973 622424711 2.120000e-115 425
31 TraesCS5A01G399300 chr7B 95.817 263 11 0 1828 2090 662732049 662731787 2.120000e-115 425
32 TraesCS5A01G399300 chr7B 97.906 191 4 0 1419 1609 622432636 622432826 4.760000e-87 331
33 TraesCS5A01G399300 chr7D 95.817 263 11 0 1828 2090 231621417 231621155 2.120000e-115 425
34 TraesCS5A01G399300 chr7D 97.906 191 4 0 1419 1609 231538223 231538033 4.760000e-87 331
35 TraesCS5A01G399300 chr7D 97.906 191 4 0 1419 1609 231572651 231572461 4.760000e-87 331
36 TraesCS5A01G399300 chr7D 97.906 191 4 0 1419 1609 231621615 231621425 4.760000e-87 331
37 TraesCS5A01G399300 chr3D 97.906 191 4 0 1419 1609 589254974 589254784 4.760000e-87 331


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G399300 chr5A 593034251 593036562 2311 True 1936.000000 2976 100.000000 1 2312 2 chr5A.!!$R3 2311
1 TraesCS5A01G399300 chr5A 593054508 593055399 891 True 1083.000000 1083 88.581000 4 902 1 chr5A.!!$R2 898
2 TraesCS5A01G399300 chr5A 592832978 592837890 4912 False 904.333333 2863 93.988333 1 2312 6 chr5A.!!$F1 2311
3 TraesCS5A01G399300 chr5A 592690657 592691273 616 True 588.000000 588 84.087000 272 903 1 chr5A.!!$R1 631
4 TraesCS5A01G399300 chr5D 473049620 473052682 3062 True 1311.666667 2475 94.132667 1 2312 3 chr5D.!!$R3 2311
5 TraesCS5A01G399300 chr5D 473038707 473041333 2626 True 725.500000 1151 87.289000 3 857 2 chr5D.!!$R2 854
6 TraesCS5A01G399300 chr5D 473063120 473064267 1147 True 724.500000 1136 90.722000 2 2312 2 chr5D.!!$R4 2310
7 TraesCS5A01G399300 chr5B 580424693 580431350 6657 True 839.333333 1182 87.093000 1 903 3 chr5B.!!$R1 902

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
914 943 6.656632 ATGCATATATACTCCCTCCATACG 57.343 41.667 0.0 0.0 0.0 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1855 2121 1.91058 GAATCCCTCCTCGCCCACAA 61.911 60.0 0.0 0.0 0.0 3.33 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
914 943 6.656632 ATGCATATATACTCCCTCCATACG 57.343 41.667 0.0 0.0 0.00 3.06
969 1005 8.342634 GCTTCAACGACATATATTTTGGTACAT 58.657 33.333 0.0 0.0 39.30 2.29
1593 1859 1.996798 ACGTCCACTATCCCGATCAT 58.003 50.000 0.0 0.0 0.00 2.45
2262 2528 1.616994 GCAGCCCCTTAGTGGAAACAT 60.617 52.381 0.0 0.0 46.14 2.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
500 501 2.295349 GTCGTTGTAGAGGTTCTGGTCA 59.705 50.000 0.00 0.0 0.00 4.02
914 943 7.278868 CCAACTTCTCCAGCGATATATATTTCC 59.721 40.741 0.00 0.0 0.00 3.13
969 1005 8.004087 ACTATGCGACTAAAATGTACTTCCTA 57.996 34.615 0.00 0.0 0.00 2.94
1160 1425 3.374678 GCGTATTCGGAATTGTACCCAAA 59.625 43.478 8.76 0.0 37.56 3.28
1855 2121 1.910580 GAATCCCTCCTCGCCCACAA 61.911 60.000 0.00 0.0 0.00 3.33


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.