Multiple sequence alignment - TraesCS5A01G382300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G382300 chr5A 100.000 2513 0 0 1 2513 580225353 580222841 0 4641
1 TraesCS5A01G382300 chr5A 97.381 2520 58 8 1 2513 639808006 639810524 0 4281
2 TraesCS5A01G382300 chr5A 96.788 2522 68 10 1 2513 483355601 483353084 0 4196
3 TraesCS5A01G382300 chr6A 97.499 2519 53 9 1 2513 468224299 468226813 0 4294
4 TraesCS5A01G382300 chr3A 97.139 2517 61 9 1 2513 654166980 654169489 0 4239
5 TraesCS5A01G382300 chr3A 96.784 2519 69 10 1 2513 480296069 480298581 0 4193
6 TraesCS5A01G382300 chr1A 97.030 2525 59 13 1 2513 257591381 257588861 0 4233
7 TraesCS5A01G382300 chr1A 96.822 2517 71 8 1 2513 549994084 549991573 0 4196
8 TraesCS5A01G382300 chr2A 96.870 2524 65 12 1 2513 538373736 538371216 0 4211


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G382300 chr5A 580222841 580225353 2512 True 4641 4641 100.000 1 2513 1 chr5A.!!$R2 2512
1 TraesCS5A01G382300 chr5A 639808006 639810524 2518 False 4281 4281 97.381 1 2513 1 chr5A.!!$F1 2512
2 TraesCS5A01G382300 chr5A 483353084 483355601 2517 True 4196 4196 96.788 1 2513 1 chr5A.!!$R1 2512
3 TraesCS5A01G382300 chr6A 468224299 468226813 2514 False 4294 4294 97.499 1 2513 1 chr6A.!!$F1 2512
4 TraesCS5A01G382300 chr3A 654166980 654169489 2509 False 4239 4239 97.139 1 2513 1 chr3A.!!$F2 2512
5 TraesCS5A01G382300 chr3A 480296069 480298581 2512 False 4193 4193 96.784 1 2513 1 chr3A.!!$F1 2512
6 TraesCS5A01G382300 chr1A 257588861 257591381 2520 True 4233 4233 97.030 1 2513 1 chr1A.!!$R1 2512
7 TraesCS5A01G382300 chr1A 549991573 549994084 2511 True 4196 4196 96.822 1 2513 1 chr1A.!!$R2 2512
8 TraesCS5A01G382300 chr2A 538371216 538373736 2520 True 4211 4211 96.870 1 2513 1 chr2A.!!$R1 2512

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
577 591 0.320073 CCAAACCCTAGCGTCGAACA 60.32 55.0 0.0 0.0 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2491 2519 2.285083 TGTAGTGTGAGTTTGGTGTGC 58.715 47.619 0.0 0.0 0.0 4.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
413 426 5.509498 ACGCCCCTATACCGAGTTTATATA 58.491 41.667 0.00 0.0 0.00 0.86
510 523 3.899052 ATGGCCATTTGAAATCTGGTG 57.101 42.857 14.09 0.0 32.42 4.17
577 591 0.320073 CCAAACCCTAGCGTCGAACA 60.320 55.000 0.00 0.0 0.00 3.18
847 864 5.338219 CCTCTTCTCCATCTGACAGACAAAT 60.338 44.000 7.47 0.0 0.00 2.32
885 902 4.734266 AGCAATTCCTCTGTTTCTTTCCT 58.266 39.130 0.00 0.0 0.00 3.36
1021 1038 2.584418 CTCGATGCCCTGACTGCG 60.584 66.667 0.00 0.0 0.00 5.18
1043 1060 2.666190 GACTGCGCCACTGAAGCA 60.666 61.111 4.18 0.0 39.25 3.91
1044 1061 2.203195 ACTGCGCCACTGAAGCAA 60.203 55.556 4.18 0.0 40.63 3.91
1416 1433 7.175641 ACGGAATTGAAGAAGATGAACAAGAAT 59.824 33.333 0.00 0.0 0.00 2.40
1538 1556 3.951037 TGTTTGTCTACTGTTGTTGCCAT 59.049 39.130 0.00 0.0 0.00 4.40
1585 1603 8.846943 TTATCTCAAATGCAACTCTGTTTAGA 57.153 30.769 0.00 0.0 0.00 2.10
1661 1679 3.942748 AGTTTCGGCAGAAAACAACTACA 59.057 39.130 13.73 0.0 46.63 2.74
2065 2087 6.311445 CAGTATTATTATGCCTAGCGAACCAG 59.689 42.308 0.00 0.0 0.00 4.00
2491 2519 0.384309 TAGATAGCTCGGGCAACACG 59.616 55.000 11.40 0.0 41.70 4.49
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
338 348 8.443160 GTGATCTGTCGAAATGAAGTTCAAATA 58.557 33.333 10.14 0.00 0.00 1.40
510 523 3.691118 GTCAACGGGGTTATTAGGGTTTC 59.309 47.826 0.00 0.00 0.00 2.78
577 591 2.910479 TAGGATCCGACGGCGCAT 60.910 61.111 4.27 0.00 35.83 4.73
641 655 3.274586 CAGGATGCATCACGCGGG 61.275 66.667 27.25 6.51 46.97 6.13
885 902 5.013547 AGAGGAAGAAGAACGAGAAGATGA 58.986 41.667 0.00 0.00 0.00 2.92
1043 1060 4.528596 TCTTCTCCTCCTTCGAAGTCAATT 59.471 41.667 23.03 0.00 36.44 2.32
1044 1061 4.090090 TCTTCTCCTCCTTCGAAGTCAAT 58.910 43.478 23.03 0.00 36.44 2.57
1209 1226 5.999205 AATGGTGGCATTTCTTCACAATA 57.001 34.783 0.00 0.00 33.45 1.90
1212 1229 3.305267 CGAAATGGTGGCATTTCTTCACA 60.305 43.478 5.61 0.00 44.83 3.58
1416 1433 3.884693 TCAACTCAATCAGCTGCTTGAAA 59.115 39.130 27.63 14.39 30.92 2.69
1585 1603 2.820059 TTCAGTGATCGACAGTTGCT 57.180 45.000 0.00 0.00 0.00 3.91
1699 1717 6.127619 CGAGCTATGGTATGATCCAATACTCA 60.128 42.308 0.00 1.88 41.09 3.41
1954 1975 7.071917 TCCTCAATGAGATAGAAGAGATTGGA 58.928 38.462 12.53 0.00 0.00 3.53
2065 2087 9.660180 AGACCTCTTTTTCTAATCATGAAGTAC 57.340 33.333 0.00 0.00 0.00 2.73
2491 2519 2.285083 TGTAGTGTGAGTTTGGTGTGC 58.715 47.619 0.00 0.00 0.00 4.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.