Multiple sequence alignment - TraesCS5A01G364800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G364800 chr5A 100.000 2997 0 0 1 2997 565287003 565284007 0 5535
1 TraesCS5A01G364800 chr5A 96.473 2353 72 7 653 2997 693843422 693845771 0 3875
2 TraesCS5A01G364800 chr7A 96.481 3012 85 12 1 2997 41970378 41973383 0 4955
3 TraesCS5A01G364800 chr7A 97.043 2942 65 10 65 2997 204191388 204194316 0 4931
4 TraesCS5A01G364800 chr7A 95.756 3016 106 16 1 2997 15521863 15518851 0 4841
5 TraesCS5A01G364800 chr6A 95.954 3015 98 16 1 2997 555104766 555101758 0 4870
6 TraesCS5A01G364800 chr6A 95.854 3015 103 13 1 2997 602797833 602794823 0 4855
7 TraesCS5A01G364800 chr6A 95.903 2685 89 13 330 2997 597467549 597464869 0 4329
8 TraesCS5A01G364800 chr3A 94.728 3016 135 16 1 2997 17913982 17910972 0 4667
9 TraesCS5A01G364800 chr3A 89.971 678 44 19 1 675 669776046 669775390 0 854
10 TraesCS5A01G364800 chr5D 94.094 3031 115 28 1 2997 36561898 36564898 0 4547
11 TraesCS5A01G364800 chr2A 93.750 848 40 8 1 838 614080 613236 0 1260
12 TraesCS5A01G364800 chr2A 93.302 851 40 12 1 838 30580150 30580996 0 1240
13 TraesCS5A01G364800 chr4A 89.294 850 59 12 1 838 600514239 600513410 0 1037


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G364800 chr5A 565284007 565287003 2996 True 5535 5535 100.000 1 2997 1 chr5A.!!$R1 2996
1 TraesCS5A01G364800 chr5A 693843422 693845771 2349 False 3875 3875 96.473 653 2997 1 chr5A.!!$F1 2344
2 TraesCS5A01G364800 chr7A 41970378 41973383 3005 False 4955 4955 96.481 1 2997 1 chr7A.!!$F1 2996
3 TraesCS5A01G364800 chr7A 204191388 204194316 2928 False 4931 4931 97.043 65 2997 1 chr7A.!!$F2 2932
4 TraesCS5A01G364800 chr7A 15518851 15521863 3012 True 4841 4841 95.756 1 2997 1 chr7A.!!$R1 2996
5 TraesCS5A01G364800 chr6A 555101758 555104766 3008 True 4870 4870 95.954 1 2997 1 chr6A.!!$R1 2996
6 TraesCS5A01G364800 chr6A 602794823 602797833 3010 True 4855 4855 95.854 1 2997 1 chr6A.!!$R3 2996
7 TraesCS5A01G364800 chr6A 597464869 597467549 2680 True 4329 4329 95.903 330 2997 1 chr6A.!!$R2 2667
8 TraesCS5A01G364800 chr3A 17910972 17913982 3010 True 4667 4667 94.728 1 2997 1 chr3A.!!$R1 2996
9 TraesCS5A01G364800 chr3A 669775390 669776046 656 True 854 854 89.971 1 675 1 chr3A.!!$R2 674
10 TraesCS5A01G364800 chr5D 36561898 36564898 3000 False 4547 4547 94.094 1 2997 1 chr5D.!!$F1 2996
11 TraesCS5A01G364800 chr2A 613236 614080 844 True 1260 1260 93.750 1 838 1 chr2A.!!$R1 837
12 TraesCS5A01G364800 chr2A 30580150 30580996 846 False 1240 1240 93.302 1 838 1 chr2A.!!$F1 837
13 TraesCS5A01G364800 chr4A 600513410 600514239 829 True 1037 1037 89.294 1 838 1 chr4A.!!$R1 837

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
245 256 3.866651 ACAACTATCTCAGCTGCGAAAT 58.133 40.909 10.99 0.0 0.0 2.17 F
1338 1404 0.257039 CACAGCCCAAGGAGCCTTAT 59.743 55.000 0.66 0.0 34.5 1.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1791 1860 0.405973 GGAAGGCCCTTTCTTCTGGT 59.594 55.0 0.0 0.0 40.17 4.0 R
2919 2995 1.358877 CATTGCGATGTCTTGGTCGA 58.641 50.0 5.7 0.0 40.11 4.2 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
245 256 3.866651 ACAACTATCTCAGCTGCGAAAT 58.133 40.909 10.99 0.00 0.00 2.17
660 694 9.618890 GCATCTCCTGAAATAATATATTGCCTA 57.381 33.333 8.28 0.00 0.00 3.93
1045 1111 7.775120 ACCAACTGAAAATAATGATGATCCAC 58.225 34.615 0.00 0.00 0.00 4.02
1214 1280 1.971357 ACAAGTACCTGCAGCTGTAGT 59.029 47.619 27.15 18.14 0.00 2.73
1338 1404 0.257039 CACAGCCCAAGGAGCCTTAT 59.743 55.000 0.66 0.00 34.50 1.73
1341 1407 0.548510 AGCCCAAGGAGCCTTATGTC 59.451 55.000 0.66 0.00 34.50 3.06
1408 1476 2.224354 GCATATTCCTTGCAAATGGGGG 60.224 50.000 0.00 0.00 39.90 5.40
1782 1851 5.428253 ACTAAGTATTTGCGATCACACCAT 58.572 37.500 0.00 0.00 0.00 3.55
1852 1921 9.243105 ACTGCAATTTAACTACAGGTATTGAAT 57.757 29.630 0.00 0.00 32.60 2.57
1940 2009 5.027460 TCTTAGCCCATCAACAAGTACCTA 58.973 41.667 0.00 0.00 0.00 3.08
2010 2079 4.455877 AGTTGCTTGATAGTGCCACTAAAC 59.544 41.667 8.93 7.60 34.16 2.01
2055 2124 9.995003 AAAGACATAAAATGCCTGATTTGTTTA 57.005 25.926 0.00 0.00 34.30 2.01
2326 2401 2.374184 GGGCATATGGTTGTAGTTGCA 58.626 47.619 4.56 0.00 0.00 4.08
2482 2557 4.893424 TGATGCACATCATGTCAGATTG 57.107 40.909 9.23 0.00 42.42 2.67
2616 2691 6.603940 ACTTTAAAGATCAGCAGAGAGAGT 57.396 37.500 21.92 0.00 0.00 3.24
2683 2759 5.064834 GGTTGAGAATATTTTCTGGGTCGAC 59.935 44.000 7.13 7.13 42.34 4.20
2919 2995 3.386932 AGCACCCACCAACATCATAAT 57.613 42.857 0.00 0.00 0.00 1.28
2977 3053 5.171339 AGATCTTTCCTACAAGTGTGCAT 57.829 39.130 0.00 0.00 0.00 3.96
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
63 65 5.813672 ACTACGCAACTGTCTCTTGTTTTTA 59.186 36.000 0.00 0.00 0.00 1.52
245 256 5.616270 TGCTCAGTATGTTTGGAAGTAACA 58.384 37.500 0.00 0.00 39.58 2.41
660 694 9.632638 AATCAGGCAAGTCAAACTATATATGTT 57.367 29.630 0.00 0.00 0.00 2.71
868 927 7.385752 CCACACAAAAATAGCTCAATCATGTTT 59.614 33.333 0.00 0.00 0.00 2.83
998 1064 6.122277 GGTTCCTCATTCAGGTCAATCATTA 58.878 40.000 0.00 0.00 43.95 1.90
1045 1111 3.120546 GCAGCATGTTGTGTACAGTACAG 60.121 47.826 14.03 2.55 40.83 2.74
1214 1280 3.305181 TGAGCATCACTCCCAGCTA 57.695 52.632 0.00 0.00 42.56 3.32
1338 1404 3.372123 TCGAACCTCATGCCGACA 58.628 55.556 0.00 0.00 0.00 4.35
1341 1407 0.670546 AAGTGTCGAACCTCATGCCG 60.671 55.000 0.00 0.00 0.00 5.69
1443 1512 4.650131 TGTTTTATCAACTCCCCGGTTTTT 59.350 37.500 0.00 0.00 0.00 1.94
1617 1686 3.551846 TCTTTTTCGGTTCTTGCTCCTT 58.448 40.909 0.00 0.00 0.00 3.36
1629 1698 7.636259 TTGCACAATTTTATCTCTTTTTCGG 57.364 32.000 0.00 0.00 0.00 4.30
1746 1815 6.868339 GCAAATACTTAGTCAAACATGGCTTT 59.132 34.615 0.00 0.00 0.00 3.51
1782 1851 1.635487 CTTTCTTCTGGTGGGATCCCA 59.365 52.381 30.62 30.62 45.02 4.37
1791 1860 0.405973 GGAAGGCCCTTTCTTCTGGT 59.594 55.000 0.00 0.00 40.17 4.00
1852 1921 1.841556 GGGAGTGAGGTGGGTGTGA 60.842 63.158 0.00 0.00 0.00 3.58
1940 2009 6.339730 TCAGTGACATGTTTCAAGCAAAAAT 58.660 32.000 0.00 0.00 0.00 1.82
2055 2124 1.216064 TAGGCAAGTCCAGCATCCAT 58.784 50.000 0.00 0.00 37.29 3.41
2146 2215 8.270744 AGACTAATCATAGGCAAGTTCAGATTT 58.729 33.333 0.00 0.00 39.88 2.17
2326 2401 5.387788 TGGGCAATTCATGAAGCTATACAT 58.612 37.500 14.54 0.00 0.00 2.29
2482 2557 3.878778 ACAATGAGTTCTGTCCCATAGC 58.121 45.455 0.00 0.00 0.00 2.97
2658 2734 4.941263 CGACCCAGAAAATATTCTCAACCA 59.059 41.667 0.00 0.00 44.11 3.67
2683 2759 3.741476 GCCTTCCTTGCTGCACCG 61.741 66.667 0.00 0.00 0.00 4.94
2919 2995 1.358877 CATTGCGATGTCTTGGTCGA 58.641 50.000 5.70 0.00 40.11 4.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.