Multiple sequence alignment - TraesCS5A01G363000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G363000 chr5A 100.000 3212 0 0 1 3212 563518947 563515736 0.000000e+00 5932
1 TraesCS5A01G363000 chr5A 99.222 3212 19 1 1 3212 563509687 563506482 0.000000e+00 5788
2 TraesCS5A01G363000 chr5A 98.350 3212 40 3 1 3212 563500435 563497237 0.000000e+00 5626
3 TraesCS5A01G363000 chr5A 96.825 3087 77 8 127 3212 563457649 563454583 0.000000e+00 5138
4 TraesCS5A01G363000 chr5A 95.048 3231 100 14 1 3212 563548670 563545481 0.000000e+00 5025
5 TraesCS5A01G363000 chr5A 97.658 1751 40 1 1 1750 563485434 563483684 0.000000e+00 3005
6 TraesCS5A01G363000 chr5A 96.693 1542 37 3 1685 3212 563568029 563566488 0.000000e+00 2553
7 TraesCS5A01G363000 chr5A 94.945 1642 61 8 4 1637 563569655 563568028 0.000000e+00 2553
8 TraesCS5A01G363000 chr5A 96.734 1439 29 3 1774 3212 563483688 563482268 0.000000e+00 2381
9 TraesCS5A01G363000 chr5A 86.912 1169 145 5 1 1163 563554013 563552847 0.000000e+00 1304
10 TraesCS5A01G363000 chr5A 86.581 1170 148 6 1 1163 563490383 563489216 0.000000e+00 1282
11 TraesCS5A01G363000 chr5A 86.313 1169 151 5 1 1163 563505859 563504694 0.000000e+00 1264
12 TraesCS5A01G363000 chr5A 86.313 1169 151 6 1 1163 563592031 563590866 0.000000e+00 1264
13 TraesCS5A01G363000 chr2B 77.179 1595 307 35 671 2244 9199059 9197501 0.000000e+00 876
14 TraesCS5A01G363000 chr2B 80.966 683 122 6 1539 2217 64810 65488 4.720000e-148 534
15 TraesCS5A01G363000 chr2A 77.145 1562 317 31 668 2217 2876195 2877728 0.000000e+00 870
16 TraesCS5A01G363000 chr4B 77.770 1471 281 29 716 2178 6083860 6085292 0.000000e+00 863
17 TraesCS5A01G363000 chr4A 77.246 1503 290 32 716 2206 601337846 601339308 0.000000e+00 833


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G363000 chr5A 563515736 563518947 3211 True 5932.000000 5932 100.000000 1 3212 1 chr5A.!!$R3 3211
1 TraesCS5A01G363000 chr5A 563497237 563500435 3198 True 5626.000000 5626 98.350000 1 3212 1 chr5A.!!$R2 3211
2 TraesCS5A01G363000 chr5A 563454583 563457649 3066 True 5138.000000 5138 96.825000 127 3212 1 chr5A.!!$R1 3085
3 TraesCS5A01G363000 chr5A 563545481 563548670 3189 True 5025.000000 5025 95.048000 1 3212 1 chr5A.!!$R4 3211
4 TraesCS5A01G363000 chr5A 563504694 563509687 4993 True 3526.000000 5788 92.767500 1 3212 2 chr5A.!!$R8 3211
5 TraesCS5A01G363000 chr5A 563566488 563569655 3167 True 2553.000000 2553 95.819000 4 3212 2 chr5A.!!$R9 3208
6 TraesCS5A01G363000 chr5A 563482268 563490383 8115 True 2222.666667 3005 93.657667 1 3212 3 chr5A.!!$R7 3211
7 TraesCS5A01G363000 chr5A 563552847 563554013 1166 True 1304.000000 1304 86.912000 1 1163 1 chr5A.!!$R5 1162
8 TraesCS5A01G363000 chr5A 563590866 563592031 1165 True 1264.000000 1264 86.313000 1 1163 1 chr5A.!!$R6 1162
9 TraesCS5A01G363000 chr2B 9197501 9199059 1558 True 876.000000 876 77.179000 671 2244 1 chr2B.!!$R1 1573
10 TraesCS5A01G363000 chr2B 64810 65488 678 False 534.000000 534 80.966000 1539 2217 1 chr2B.!!$F1 678
11 TraesCS5A01G363000 chr2A 2876195 2877728 1533 False 870.000000 870 77.145000 668 2217 1 chr2A.!!$F1 1549
12 TraesCS5A01G363000 chr4B 6083860 6085292 1432 False 863.000000 863 77.770000 716 2178 1 chr4B.!!$F1 1462
13 TraesCS5A01G363000 chr4A 601337846 601339308 1462 False 833.000000 833 77.246000 716 2206 1 chr4A.!!$F1 1490

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1131 6104 1.001974 CGTGACAAGGTGGAGAATGGA 59.998 52.381 0.0 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2713 7703 2.359214 TCTCTCTCTGTGTGTGTGTGTC 59.641 50.0 0.0 0.0 0.0 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1131 6104 1.001974 CGTGACAAGGTGGAGAATGGA 59.998 52.381 0.00 0.0 0.00 3.41
1239 6212 0.951040 CCACACCTCTCTTTGGCGTC 60.951 60.000 0.00 0.0 0.00 5.19
2560 7542 9.025041 GGCCATACCTAGATTATTAGCATTTTT 57.975 33.333 0.00 0.0 34.51 1.94
2713 7703 6.395426 AGACATTAGCAATGAGAGAGAGAG 57.605 41.667 13.53 0.0 41.46 3.20
2722 7712 3.214696 TGAGAGAGAGAGACACACACA 57.785 47.619 0.00 0.0 0.00 3.72
2723 7713 2.881513 TGAGAGAGAGAGACACACACAC 59.118 50.000 0.00 0.0 0.00 3.82
2724 7714 2.881513 GAGAGAGAGAGACACACACACA 59.118 50.000 0.00 0.0 0.00 3.72
2725 7715 2.621055 AGAGAGAGAGACACACACACAC 59.379 50.000 0.00 0.0 0.00 3.82
2726 7716 2.359214 GAGAGAGAGACACACACACACA 59.641 50.000 0.00 0.0 0.00 3.72
2727 7717 2.360483 AGAGAGAGACACACACACACAG 59.640 50.000 0.00 0.0 0.00 3.66
2728 7718 2.359214 GAGAGAGACACACACACACAGA 59.641 50.000 0.00 0.0 0.00 3.41
2729 7719 2.360483 AGAGAGACACACACACACAGAG 59.640 50.000 0.00 0.0 0.00 3.35
2730 7720 2.359214 GAGAGACACACACACACAGAGA 59.641 50.000 0.00 0.0 0.00 3.10
2731 7721 2.360483 AGAGACACACACACACAGAGAG 59.640 50.000 0.00 0.0 0.00 3.20
2732 7722 2.359214 GAGACACACACACACAGAGAGA 59.641 50.000 0.00 0.0 0.00 3.10
2733 7723 2.360483 AGACACACACACACAGAGAGAG 59.640 50.000 0.00 0.0 0.00 3.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1131 6104 6.187682 CAGGTGGGAAAATAATGGTAGAAGT 58.812 40.000 0.00 0.0 0.00 3.01
1239 6212 3.775654 GACAGGAGGCCAGGGTCG 61.776 72.222 5.01 0.0 0.00 4.79
1778 6757 2.787601 AAGAGTCTCGTACAACGCAA 57.212 45.000 0.00 0.0 42.21 4.85
2560 7542 7.823799 TCTGATTACATACAGCTCAATCAAACA 59.176 33.333 0.00 0.0 35.74 2.83
2713 7703 2.359214 TCTCTCTCTGTGTGTGTGTGTC 59.641 50.000 0.00 0.0 0.00 3.67
2722 7712 4.096681 TCTCTCTCTCTCTCTCTCTGTGT 58.903 47.826 0.00 0.0 0.00 3.72
2723 7713 4.403752 TCTCTCTCTCTCTCTCTCTCTGTG 59.596 50.000 0.00 0.0 0.00 3.66
2724 7714 4.614475 TCTCTCTCTCTCTCTCTCTCTGT 58.386 47.826 0.00 0.0 0.00 3.41
2725 7715 4.892345 TCTCTCTCTCTCTCTCTCTCTCTG 59.108 50.000 0.00 0.0 0.00 3.35
2726 7716 5.103728 TCTCTCTCTCTCTCTCTCTCTCTCT 60.104 48.000 0.00 0.0 0.00 3.10
2727 7717 5.009610 GTCTCTCTCTCTCTCTCTCTCTCTC 59.990 52.000 0.00 0.0 0.00 3.20
2728 7718 4.892934 GTCTCTCTCTCTCTCTCTCTCTCT 59.107 50.000 0.00 0.0 0.00 3.10
2729 7719 4.261405 CGTCTCTCTCTCTCTCTCTCTCTC 60.261 54.167 0.00 0.0 0.00 3.20
2730 7720 3.634448 CGTCTCTCTCTCTCTCTCTCTCT 59.366 52.174 0.00 0.0 0.00 3.10
2731 7721 3.632604 TCGTCTCTCTCTCTCTCTCTCTC 59.367 52.174 0.00 0.0 0.00 3.20
2732 7722 3.632333 TCGTCTCTCTCTCTCTCTCTCT 58.368 50.000 0.00 0.0 0.00 3.10
2733 7723 4.363999 CTTCGTCTCTCTCTCTCTCTCTC 58.636 52.174 0.00 0.0 0.00 3.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.