Multiple sequence alignment - TraesCS5A01G362800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G362800 chr5A 100.000 2360 0 0 1 2360 563499583 563497224 0 4359
1 TraesCS5A01G362800 chr5A 98.141 2367 37 2 1 2360 563508835 563506469 0 4120
2 TraesCS5A01G362800 chr5A 97.935 2373 36 3 1 2360 563518095 563515723 0 4098
3 TraesCS5A01G362800 chr5A 96.993 2361 63 4 1 2360 563456923 563454570 0 3960
4 TraesCS5A01G362800 chr5A 95.105 2370 79 9 1 2360 563547810 563545468 0 3699
5 TraesCS5A01G362800 chr5A 95.241 1555 47 5 833 2360 563568029 563566475 0 2436
6 TraesCS5A01G362800 chr5A 96.944 1440 37 4 922 2360 563483688 563482255 0 2409
7 TraesCS5A01G362800 chr5A 98.552 898 13 0 1 898 563484581 563483684 0 1587
8 TraesCS5A01G362800 chr5A 96.306 785 29 0 1 785 563568812 563568028 0 1290
9 TraesCS5A01G362800 chr4B 79.545 1276 228 21 57 1326 6084044 6085292 0 880
10 TraesCS5A01G362800 chr4A 78.593 1308 241 23 57 1354 601338030 601339308 0 828
11 TraesCS5A01G362800 chr2A 77.130 1373 277 28 1 1365 2876385 2877728 0 761
12 TraesCS5A01G362800 chr2D 76.023 1368 282 25 1 1360 2688616 2687287 0 667


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G362800 chr5A 563497224 563499583 2359 True 4359 4359 100.0000 1 2360 1 chr5A.!!$R2 2359
1 TraesCS5A01G362800 chr5A 563506469 563508835 2366 True 4120 4120 98.1410 1 2360 1 chr5A.!!$R3 2359
2 TraesCS5A01G362800 chr5A 563515723 563518095 2372 True 4098 4098 97.9350 1 2360 1 chr5A.!!$R4 2359
3 TraesCS5A01G362800 chr5A 563454570 563456923 2353 True 3960 3960 96.9930 1 2360 1 chr5A.!!$R1 2359
4 TraesCS5A01G362800 chr5A 563545468 563547810 2342 True 3699 3699 95.1050 1 2360 1 chr5A.!!$R5 2359
5 TraesCS5A01G362800 chr5A 563482255 563484581 2326 True 1998 2409 97.7480 1 2360 2 chr5A.!!$R6 2359
6 TraesCS5A01G362800 chr5A 563566475 563568812 2337 True 1863 2436 95.7735 1 2360 2 chr5A.!!$R7 2359
7 TraesCS5A01G362800 chr4B 6084044 6085292 1248 False 880 880 79.5450 57 1326 1 chr4B.!!$F1 1269
8 TraesCS5A01G362800 chr4A 601338030 601339308 1278 False 828 828 78.5930 57 1354 1 chr4A.!!$F1 1297
9 TraesCS5A01G362800 chr2A 2876385 2877728 1343 False 761 761 77.1300 1 1365 1 chr2A.!!$F1 1364
10 TraesCS5A01G362800 chr2D 2687287 2688616 1329 True 667 667 76.0230 1 1360 1 chr2D.!!$R1 1359

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
260 261 2.584835 AGTATGGCAACTTGCTTCCA 57.415 45.0 13.43 3.9 44.28 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1547 1563 2.47099 TCTGAGGCAAGCTATCCTTCA 58.529 47.619 7.97 6.99 31.71 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
260 261 2.584835 AGTATGGCAACTTGCTTCCA 57.415 45.000 13.43 3.90 44.28 3.53
905 914 6.962182 TGATCTTTGAACCAGAGGATACAAT 58.038 36.000 0.00 0.00 41.41 2.71
1547 1563 2.841595 GGGGACGAGGATGAGGATT 58.158 57.895 0.00 0.00 0.00 3.01
1565 1581 3.434167 GGATTGAAGGATAGCTTGCCTCA 60.434 47.826 7.44 5.44 32.07 3.86
1569 1585 2.998316 AGGATAGCTTGCCTCAGAAC 57.002 50.000 0.00 0.00 0.00 3.01
1648 1664 6.529829 TGTGCTTTGTATTTTGTCTTGTTGAC 59.470 34.615 0.00 0.00 45.54 3.18
1776 1793 1.812235 TGAGTGAATGAATGCGCACT 58.188 45.000 14.90 0.00 43.67 4.40
1823 1840 1.049402 GCCCACCTATCTACTCCACC 58.951 60.000 0.00 0.00 0.00 4.61
2040 2097 6.015940 GGAATCAACATCTGTTTTGAAGGAGT 60.016 38.462 0.00 0.00 35.42 3.85
2147 2204 2.814280 ATAGCGGCATAAGCGTTAGT 57.186 45.000 1.45 0.00 43.41 2.24
2354 2425 7.986889 TGAGCACTCTATATTTTAAGCATCACA 59.013 33.333 0.00 0.00 0.00 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
257 258 2.025981 CCATTCTCCACCTTGTCATGGA 60.026 50.000 11.60 2.76 42.88 3.41
260 261 1.341383 GGCCATTCTCCACCTTGTCAT 60.341 52.381 0.00 0.00 0.00 3.06
1159 1173 2.810852 CTGAGTTGAAGGCCAAGAACTC 59.189 50.000 23.84 23.84 43.05 3.01
1341 1357 6.653320 TGTAATGTTACAATTCTCGCTTCCTT 59.347 34.615 3.25 0.00 40.43 3.36
1547 1563 2.470990 TCTGAGGCAAGCTATCCTTCA 58.529 47.619 7.97 6.99 31.71 3.02
1565 1581 5.072329 TCCAAGAGAGACAGAAAATGGTTCT 59.928 40.000 0.00 0.00 0.00 3.01
1569 1585 3.681897 CGTCCAAGAGAGACAGAAAATGG 59.318 47.826 0.00 0.00 33.70 3.16
1648 1664 4.744570 TCTAAGTAGAAACCATGAGTGCG 58.255 43.478 0.00 0.00 0.00 5.34
1776 1793 2.766263 AGGACGAATGTTCATGGAGCTA 59.234 45.455 0.00 0.00 0.00 3.32
1823 1840 4.032104 GCTAATGTCTAAAACGTGGTACCG 59.968 45.833 7.57 0.00 0.00 4.02
2040 2097 8.258007 AGAAAGAAATGTATATCCTTCGTGACA 58.742 33.333 0.00 0.00 0.00 3.58
2147 2204 5.337250 CGGCACTATAGCACCCATTTATCTA 60.337 44.000 0.00 0.00 35.83 1.98
2288 2359 4.095483 CGGTCATAGAAGCAGCAAAGAAAT 59.905 41.667 0.00 0.00 0.00 2.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.