Multiple sequence alignment - TraesCS5A01G360800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G360800 chr5A 100.000 2636 0 0 1 2636 562123259 562120624 0.000000e+00 4868
1 TraesCS5A01G360800 chr5A 97.726 2331 39 3 320 2636 687969718 687972048 0.000000e+00 3999
2 TraesCS5A01G360800 chr5A 94.888 2543 86 9 1 2506 40241629 40239094 0.000000e+00 3936
3 TraesCS5A01G360800 chr5A 91.209 2696 140 32 1 2633 310017874 310020535 0.000000e+00 3576
4 TraesCS5A01G360800 chr5A 98.276 348 5 1 1 347 687969339 687969686 2.240000e-170 608
5 TraesCS5A01G360800 chr1A 97.390 2644 60 4 1 2636 16224722 16227364 0.000000e+00 4492
6 TraesCS5A01G360800 chr1A 97.553 1921 46 1 715 2634 16218846 16220766 0.000000e+00 3286
7 TraesCS5A01G360800 chr5D 96.174 2535 66 6 1 2506 437728598 437726066 0.000000e+00 4115
8 TraesCS5A01G360800 chr5D 96.197 2209 61 5 320 2506 51585551 51583344 0.000000e+00 3592
9 TraesCS5A01G360800 chr7A 97.519 2378 49 6 264 2636 49821366 49823738 0.000000e+00 4056
10 TraesCS5A01G360800 chr7A 93.219 988 38 9 1531 2506 91598091 91599061 0.000000e+00 1426
11 TraesCS5A01G360800 chr7A 80.609 624 69 38 2026 2636 219416630 219417214 4.030000e-118 435
12 TraesCS5A01G360800 chr7A 80.796 427 53 23 2026 2441 654336586 654336994 9.160000e-80 307
13 TraesCS5A01G360800 chr7A 96.732 153 1 4 2487 2636 683562740 683562891 4.360000e-63 252
14 TraesCS5A01G360800 chr6A 97.626 2317 40 6 324 2636 553572477 553570172 0.000000e+00 3960
15 TraesCS5A01G360800 chr6A 96.484 2190 69 4 320 2506 577152216 577154400 0.000000e+00 3611
16 TraesCS5A01G360800 chr2A 90.937 982 42 11 1537 2506 22372698 22371752 0.000000e+00 1277
17 TraesCS5A01G360800 chr2A 80.317 630 60 36 2026 2636 556200127 556199543 4.060000e-113 418
18 TraesCS5A01G360800 chr2A 96.732 153 1 4 2487 2636 539385547 539385396 4.360000e-63 252
19 TraesCS5A01G360800 chr2A 98.485 132 1 1 2506 2636 731840201 731840332 5.670000e-57 231
20 TraesCS5A01G360800 chr2A 97.727 132 2 1 2506 2636 691570902 691571033 2.640000e-55 226
21 TraesCS5A01G360800 chr3B 90.000 540 21 5 1 534 80425681 80426193 0.000000e+00 667
22 TraesCS5A01G360800 chr3A 93.902 328 13 3 1 321 604765339 604765666 3.050000e-134 488
23 TraesCS5A01G360800 chr2B 94.937 237 5 2 167 402 52187438 52187208 5.360000e-97 364
24 TraesCS5A01G360800 chr5B 93.810 210 7 2 1 204 34584621 34584412 7.080000e-81 311
25 TraesCS5A01G360800 chr5B 92.381 210 8 4 1 204 31737432 31737225 2.570000e-75 292
26 TraesCS5A01G360800 chr5B 91.905 210 10 3 1 204 547150338 547150130 1.190000e-73 287
27 TraesCS5A01G360800 chr5B 93.605 172 6 1 1 167 36453268 36453097 4.360000e-63 252
28 TraesCS5A01G360800 chr5B 93.605 172 6 1 1 167 621788490 621788319 4.360000e-63 252
29 TraesCS5A01G360800 chr4A 93.333 210 8 2 1 204 699841709 699841918 3.300000e-79 305
30 TraesCS5A01G360800 chr4A 91.981 212 12 5 114 321 314497772 314497562 2.570000e-75 292
31 TraesCS5A01G360800 chr7B 92.857 210 9 2 1 204 18363655 18363446 1.530000e-77 300
32 TraesCS5A01G360800 chr7B 92.857 210 8 3 1 204 57241502 57241294 5.520000e-77 298
33 TraesCS5A01G360800 chr6B 93.023 172 7 1 1 167 586281626 586281455 2.030000e-61 246
34 TraesCS5A01G360800 chr6B 91.279 172 10 1 1 167 21617513 21617342 2.040000e-56 230


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G360800 chr5A 562120624 562123259 2635 True 4868.0 4868 100.0000 1 2636 1 chr5A.!!$R2 2635
1 TraesCS5A01G360800 chr5A 40239094 40241629 2535 True 3936.0 3936 94.8880 1 2506 1 chr5A.!!$R1 2505
2 TraesCS5A01G360800 chr5A 310017874 310020535 2661 False 3576.0 3576 91.2090 1 2633 1 chr5A.!!$F1 2632
3 TraesCS5A01G360800 chr5A 687969339 687972048 2709 False 2303.5 3999 98.0010 1 2636 2 chr5A.!!$F2 2635
4 TraesCS5A01G360800 chr1A 16218846 16227364 8518 False 3889.0 4492 97.4715 1 2636 2 chr1A.!!$F1 2635
5 TraesCS5A01G360800 chr5D 437726066 437728598 2532 True 4115.0 4115 96.1740 1 2506 1 chr5D.!!$R2 2505
6 TraesCS5A01G360800 chr5D 51583344 51585551 2207 True 3592.0 3592 96.1970 320 2506 1 chr5D.!!$R1 2186
7 TraesCS5A01G360800 chr7A 49821366 49823738 2372 False 4056.0 4056 97.5190 264 2636 1 chr7A.!!$F1 2372
8 TraesCS5A01G360800 chr7A 91598091 91599061 970 False 1426.0 1426 93.2190 1531 2506 1 chr7A.!!$F2 975
9 TraesCS5A01G360800 chr7A 219416630 219417214 584 False 435.0 435 80.6090 2026 2636 1 chr7A.!!$F3 610
10 TraesCS5A01G360800 chr6A 553570172 553572477 2305 True 3960.0 3960 97.6260 324 2636 1 chr6A.!!$R1 2312
11 TraesCS5A01G360800 chr6A 577152216 577154400 2184 False 3611.0 3611 96.4840 320 2506 1 chr6A.!!$F1 2186
12 TraesCS5A01G360800 chr2A 22371752 22372698 946 True 1277.0 1277 90.9370 1537 2506 1 chr2A.!!$R1 969
13 TraesCS5A01G360800 chr2A 556199543 556200127 584 True 418.0 418 80.3170 2026 2636 1 chr2A.!!$R3 610
14 TraesCS5A01G360800 chr3B 80425681 80426193 512 False 667.0 667 90.0000 1 534 1 chr3B.!!$F1 533

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
672 6640 9.994432 CTGTTGAGTATTTTGAGGAATGAATAC 57.006 33.333 0.0 0.0 35.98 1.89 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2364 8493 2.842208 TTGGCAGAGACAAAAACACG 57.158 45.0 0.0 0.0 0.0 4.49 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
672 6640 9.994432 CTGTTGAGTATTTTGAGGAATGAATAC 57.006 33.333 0.00 0.00 35.98 1.89
1041 7023 2.853290 GCTTGTGGCACTGCTGCTT 61.853 57.895 19.83 0.00 43.66 3.91
1302 7292 5.644644 AGCTTTTCTGACTCAAAGTTGTTG 58.355 37.500 3.15 0.00 33.27 3.33
1429 7419 6.727824 ATATTTCACCTTCGTATGCATAGC 57.272 37.500 6.67 1.59 0.00 2.97
1839 7835 9.975218 ATAGTAGAATGGTATTTTGTTTCAGGT 57.025 29.630 0.00 0.00 0.00 4.00
1971 7967 6.001460 ACAACAAAAAGCATGGTACTAGCTA 58.999 36.000 0.00 0.00 38.09 3.32
2040 8037 7.665559 GTCTGTTCATAATATATTTGCCCCAGA 59.334 37.037 2.68 7.74 0.00 3.86
2204 8231 6.372103 TCGAAGTTTTTGTCCTGTTGAAGTTA 59.628 34.615 0.00 0.00 0.00 2.24
2205 8232 7.066525 TCGAAGTTTTTGTCCTGTTGAAGTTAT 59.933 33.333 0.00 0.00 0.00 1.89
2364 8493 5.629435 GGTTGCTCTTGTTTAAGTATTGTGC 59.371 40.000 0.00 0.00 35.38 4.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
672 6640 9.930693 GATAATCCTAACTCCATACTTAACAGG 57.069 37.037 0.00 0.0 0.00 4.00
1041 7023 1.133181 TCCAGGACATGTTGAGGCCA 61.133 55.000 5.01 0.0 0.00 5.36
1302 7292 5.701290 AGTAAAACTCATGCAGTACCAAGTC 59.299 40.000 0.00 0.0 32.30 3.01
1429 7419 8.745837 GTCATGCAATATTCAAACCGAATAAAG 58.254 33.333 0.00 0.0 46.99 1.85
1839 7835 4.319139 AAATGCACTACAACACATTGCA 57.681 36.364 0.00 0.0 46.59 4.08
2040 8037 9.463902 ACATGAATCAGAGAAGAATGAGAAAAT 57.536 29.630 0.00 0.0 0.00 1.82
2204 8231 7.831690 TCGCTGGACTCTCTCATATTTCTATAT 59.168 37.037 0.00 0.0 0.00 0.86
2205 8232 7.168905 TCGCTGGACTCTCTCATATTTCTATA 58.831 38.462 0.00 0.0 0.00 1.31
2364 8493 2.842208 TTGGCAGAGACAAAAACACG 57.158 45.000 0.00 0.0 0.00 4.49


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.