Multiple sequence alignment - TraesCS5A01G348700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G348700 chr5A 100.000 2648 0 0 1 2648 552264195 552261548 0 4891
1 TraesCS5A01G348700 chr5A 95.470 1766 63 5 1 1754 573012187 573010427 0 2802
2 TraesCS5A01G348700 chr5A 95.359 1767 55 5 1 1751 634624196 634625951 0 2784
3 TraesCS5A01G348700 chr5A 98.659 895 11 1 1755 2648 552253859 552252965 0 1585
4 TraesCS5A01G348700 chr5A 98.103 896 16 1 1754 2648 336257267 336256372 0 1559
5 TraesCS5A01G348700 chr7A 96.319 1766 46 5 1 1751 689936430 689938191 0 2883
6 TraesCS5A01G348700 chr7A 98.331 899 13 2 1751 2648 379346058 379345161 0 1576
7 TraesCS5A01G348700 chr7A 97.989 895 16 2 1755 2648 247010658 247009765 0 1552
8 TraesCS5A01G348700 chr7A 97.989 895 17 1 1755 2648 304500417 304499523 0 1552
9 TraesCS5A01G348700 chr7A 97.989 895 17 1 1755 2648 379337778 379336884 0 1552
10 TraesCS5A01G348700 chr7A 97.877 895 18 1 1755 2648 292727178 292726284 0 1546
11 TraesCS5A01G348700 chr1A 96.372 1764 42 5 1 1754 572001369 571999618 0 2883
12 TraesCS5A01G348700 chr1A 98.101 895 16 1 1755 2648 359791326 359790432 0 1557
13 TraesCS5A01G348700 chr1A 97.879 896 18 1 1754 2648 437527941 437527046 0 1548
14 TraesCS5A01G348700 chr2A 92.673 1747 114 10 10 1754 38507296 38505562 0 2505
15 TraesCS5A01G348700 chr3A 92.669 1746 114 11 10 1754 22779031 22777299 0 2503
16 TraesCS5A01G348700 chr5B 92.084 1756 111 17 1 1754 418362456 418360727 0 2447
17 TraesCS5A01G348700 chr1B 91.178 1791 104 22 1 1754 539849915 539848142 0 2383
18 TraesCS5A01G348700 chr3B 90.261 1725 118 20 6 1692 13529208 13530920 0 2209
19 TraesCS5A01G348700 chr3B 89.559 1724 118 24 6 1692 13510205 13511903 0 2130
20 TraesCS5A01G348700 chr7B 89.721 1469 141 7 287 1754 9313998 9312539 0 1868
21 TraesCS5A01G348700 chr6B 86.111 1764 201 25 10 1751 417301777 417303518 0 1860


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G348700 chr5A 552261548 552264195 2647 True 4891 4891 100.000 1 2648 1 chr5A.!!$R3 2647
1 TraesCS5A01G348700 chr5A 573010427 573012187 1760 True 2802 2802 95.470 1 1754 1 chr5A.!!$R4 1753
2 TraesCS5A01G348700 chr5A 634624196 634625951 1755 False 2784 2784 95.359 1 1751 1 chr5A.!!$F1 1750
3 TraesCS5A01G348700 chr5A 552252965 552253859 894 True 1585 1585 98.659 1755 2648 1 chr5A.!!$R2 893
4 TraesCS5A01G348700 chr5A 336256372 336257267 895 True 1559 1559 98.103 1754 2648 1 chr5A.!!$R1 894
5 TraesCS5A01G348700 chr7A 689936430 689938191 1761 False 2883 2883 96.319 1 1751 1 chr7A.!!$F1 1750
6 TraesCS5A01G348700 chr7A 379345161 379346058 897 True 1576 1576 98.331 1751 2648 1 chr7A.!!$R5 897
7 TraesCS5A01G348700 chr7A 247009765 247010658 893 True 1552 1552 97.989 1755 2648 1 chr7A.!!$R1 893
8 TraesCS5A01G348700 chr7A 304499523 304500417 894 True 1552 1552 97.989 1755 2648 1 chr7A.!!$R3 893
9 TraesCS5A01G348700 chr7A 379336884 379337778 894 True 1552 1552 97.989 1755 2648 1 chr7A.!!$R4 893
10 TraesCS5A01G348700 chr7A 292726284 292727178 894 True 1546 1546 97.877 1755 2648 1 chr7A.!!$R2 893
11 TraesCS5A01G348700 chr1A 571999618 572001369 1751 True 2883 2883 96.372 1 1754 1 chr1A.!!$R3 1753
12 TraesCS5A01G348700 chr1A 359790432 359791326 894 True 1557 1557 98.101 1755 2648 1 chr1A.!!$R1 893
13 TraesCS5A01G348700 chr1A 437527046 437527941 895 True 1548 1548 97.879 1754 2648 1 chr1A.!!$R2 894
14 TraesCS5A01G348700 chr2A 38505562 38507296 1734 True 2505 2505 92.673 10 1754 1 chr2A.!!$R1 1744
15 TraesCS5A01G348700 chr3A 22777299 22779031 1732 True 2503 2503 92.669 10 1754 1 chr3A.!!$R1 1744
16 TraesCS5A01G348700 chr5B 418360727 418362456 1729 True 2447 2447 92.084 1 1754 1 chr5B.!!$R1 1753
17 TraesCS5A01G348700 chr1B 539848142 539849915 1773 True 2383 2383 91.178 1 1754 1 chr1B.!!$R1 1753
18 TraesCS5A01G348700 chr3B 13529208 13530920 1712 False 2209 2209 90.261 6 1692 1 chr3B.!!$F2 1686
19 TraesCS5A01G348700 chr3B 13510205 13511903 1698 False 2130 2130 89.559 6 1692 1 chr3B.!!$F1 1686
20 TraesCS5A01G348700 chr7B 9312539 9313998 1459 True 1868 1868 89.721 287 1754 1 chr7B.!!$R1 1467
21 TraesCS5A01G348700 chr6B 417301777 417303518 1741 False 1860 1860 86.111 10 1751 1 chr6B.!!$F1 1741

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
619 677 0.315251 GCTTTTCTGGGCTTGTGACC 59.685 55.0 0.0 0.0 43.36 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1751 1838 1.070134 TGAGGTCTGGTTGCTACACAC 59.93 52.381 0.0 0.0 0.0 3.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
280 281 1.343069 GTCCTCACCACCTCACTCTT 58.657 55.000 0.00 0.0 0.00 2.85
334 361 2.159114 GCTCCTCTTCTTCTTCTCGCAT 60.159 50.000 0.00 0.0 0.00 4.73
515 571 5.594725 GGTTTGAAGAAGGATAGGGATTTCC 59.405 44.000 0.00 0.0 0.00 3.13
542 598 6.417191 TTTAAGTTCATGTATGCGAGTTCC 57.583 37.500 0.00 0.0 0.00 3.62
619 677 0.315251 GCTTTTCTGGGCTTGTGACC 59.685 55.000 0.00 0.0 43.36 4.02
1057 1126 3.071671 CCCCTTGGCCTGTGATTTT 57.928 52.632 3.32 0.0 0.00 1.82
1503 1578 0.036022 AGCTCTTGAAGGCAGGTCAC 59.964 55.000 8.07 0.0 0.00 3.67
1760 1847 8.924303 AGATAATCCTATTTGTAGTGTGTAGCA 58.076 33.333 0.00 0.0 0.00 3.49
1820 1907 4.284490 GTCATCCCTGGATCAGTAATGCTA 59.716 45.833 0.00 0.0 31.62 3.49
1979 2066 3.763557 AATGGGTCCATCAACTCCAAT 57.236 42.857 2.62 0.0 35.31 3.16
1989 2076 3.998913 TCAACTCCAATGGCATCACTA 57.001 42.857 0.00 0.0 0.00 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
4 5 2.167900 GGTAGTTCTGTGGGACGCTTAT 59.832 50.000 0.00 0.0 40.97 1.73
150 151 2.742116 TTAGCGTGGCCTCCATCCC 61.742 63.158 3.32 0.0 35.28 3.85
280 281 1.679305 GAGCAGAGTGAGTCGGGGA 60.679 63.158 0.00 0.0 0.00 4.81
515 571 5.296780 ACTCGCATACATGAACTTAAATGGG 59.703 40.000 0.00 0.6 0.00 4.00
542 598 6.317140 AGCAGGAAACACATATATGTCAACTG 59.683 38.462 15.60 17.6 39.39 3.16
619 677 0.172578 TGCACCTACGGTCAGATTCG 59.827 55.000 0.00 0.0 31.02 3.34
1057 1126 0.747255 TTGGTTAAGCGCCTTTGCAA 59.253 45.000 2.29 0.0 37.32 4.08
1218 1291 3.205056 TCTGCCCATCCTGGTAATCAAAT 59.795 43.478 0.00 0.0 35.17 2.32
1503 1578 2.095718 GTCTAGCTTTTCTTTGCACCCG 60.096 50.000 0.00 0.0 0.00 5.28
1751 1838 1.070134 TGAGGTCTGGTTGCTACACAC 59.930 52.381 0.00 0.0 0.00 3.82
1820 1907 3.390135 CTTCGATGTACTGTGTGGTGTT 58.610 45.455 0.00 0.0 0.00 3.32
1979 2066 2.637872 GGCCCTATACTTAGTGATGCCA 59.362 50.000 0.00 0.0 36.40 4.92
1989 2076 5.690364 GCTTTTAGGTCATGGCCCTATACTT 60.690 44.000 14.18 0.0 34.59 2.24
2248 2336 5.337009 GGATTGAGAATGCTGTCAACCATTT 60.337 40.000 1.27 0.0 37.63 2.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.