Multiple sequence alignment - TraesCS5A01G330300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G330300 chr5A 100.000 2388 0 0 1 2388 539825675 539823288 0.000000e+00 4410
1 TraesCS5A01G330300 chr5A 97.070 2389 66 4 1 2387 374024446 374022060 0.000000e+00 4021
2 TraesCS5A01G330300 chr5A 93.750 80 3 1 304 381 630722938 630723017 4.170000e-23 119
3 TraesCS5A01G330300 chr7A 96.651 2389 75 5 1 2387 25224712 25222327 0.000000e+00 3964
4 TraesCS5A01G330300 chr7A 93.263 2078 123 9 1 2066 116468466 116466394 0.000000e+00 3046
5 TraesCS5A01G330300 chr6A 95.272 2390 108 5 1 2387 471275618 471273231 0.000000e+00 3783
6 TraesCS5A01G330300 chr3A 96.323 2094 72 5 1 2091 496386021 496388112 0.000000e+00 3435
7 TraesCS5A01G330300 chr3D 93.671 2070 120 8 1 2066 578589352 578591414 0.000000e+00 3086
8 TraesCS5A01G330300 chr4D 92.523 2073 127 14 1 2066 168888699 168890750 0.000000e+00 2944
9 TraesCS5A01G330300 chr2D 95.954 1730 65 4 660 2387 92462904 92464630 0.000000e+00 2802
10 TraesCS5A01G330300 chr2D 94.152 171 10 0 61 231 92462666 92462836 6.550000e-66 261
11 TraesCS5A01G330300 chr2D 95.522 67 3 0 566 632 92462839 92462905 9.030000e-20 108
12 TraesCS5A01G330300 chr5B 95.652 1265 54 1 1124 2387 617730963 617729699 0.000000e+00 2030
13 TraesCS5A01G330300 chrUn 97.002 567 14 2 1822 2387 1841802 1842366 0.000000e+00 950
14 TraesCS5A01G330300 chrUn 96.825 567 16 2 1822 2387 280615524 280614959 0.000000e+00 946
15 TraesCS5A01G330300 chr3B 96.831 568 16 2 1822 2387 796759016 796758449 0.000000e+00 948
16 TraesCS5A01G330300 chr2B 96.825 567 16 2 1822 2387 742333694 742334259 0.000000e+00 946
17 TraesCS5A01G330300 chr5D 93.451 397 24 1 1 395 61858923 61859319 2.640000e-164 588


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G330300 chr5A 539823288 539825675 2387 True 4410 4410 100.000000 1 2388 1 chr5A.!!$R2 2387
1 TraesCS5A01G330300 chr5A 374022060 374024446 2386 True 4021 4021 97.070000 1 2387 1 chr5A.!!$R1 2386
2 TraesCS5A01G330300 chr7A 25222327 25224712 2385 True 3964 3964 96.651000 1 2387 1 chr7A.!!$R1 2386
3 TraesCS5A01G330300 chr7A 116466394 116468466 2072 True 3046 3046 93.263000 1 2066 1 chr7A.!!$R2 2065
4 TraesCS5A01G330300 chr6A 471273231 471275618 2387 True 3783 3783 95.272000 1 2387 1 chr6A.!!$R1 2386
5 TraesCS5A01G330300 chr3A 496386021 496388112 2091 False 3435 3435 96.323000 1 2091 1 chr3A.!!$F1 2090
6 TraesCS5A01G330300 chr3D 578589352 578591414 2062 False 3086 3086 93.671000 1 2066 1 chr3D.!!$F1 2065
7 TraesCS5A01G330300 chr4D 168888699 168890750 2051 False 2944 2944 92.523000 1 2066 1 chr4D.!!$F1 2065
8 TraesCS5A01G330300 chr2D 92462666 92464630 1964 False 1057 2802 95.209333 61 2387 3 chr2D.!!$F1 2326
9 TraesCS5A01G330300 chr5B 617729699 617730963 1264 True 2030 2030 95.652000 1124 2387 1 chr5B.!!$R1 1263
10 TraesCS5A01G330300 chrUn 1841802 1842366 564 False 950 950 97.002000 1822 2387 1 chrUn.!!$F1 565
11 TraesCS5A01G330300 chrUn 280614959 280615524 565 True 946 946 96.825000 1822 2387 1 chrUn.!!$R1 565
12 TraesCS5A01G330300 chr3B 796758449 796759016 567 True 948 948 96.831000 1822 2387 1 chr3B.!!$R1 565
13 TraesCS5A01G330300 chr2B 742333694 742334259 565 False 946 946 96.825000 1822 2387 1 chr2B.!!$F1 565

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
101 103 1.599542 ACTGAGAGTTTGCAAACGAGC 59.4 47.619 30.9 24.26 43.51 5.03 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1529 1551 1.745087 GATGTCGCCCATGATGTTTGT 59.255 47.619 0.0 0.0 32.56 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
101 103 1.599542 ACTGAGAGTTTGCAAACGAGC 59.400 47.619 30.90 24.26 43.51 5.03
367 372 6.759827 TCCAGACCAACTAAATATACGCTTTC 59.240 38.462 0.00 0.00 0.00 2.62
434 439 5.604565 TCAGTGCATATGATGAAACGAGAT 58.395 37.500 6.97 0.00 0.00 2.75
447 452 5.305585 TGAAACGAGATTTAAGAAGTGGCT 58.694 37.500 0.00 0.00 0.00 4.75
448 453 5.179368 TGAAACGAGATTTAAGAAGTGGCTG 59.821 40.000 0.00 0.00 0.00 4.85
604 612 4.820897 TCCTTGATTAGTATGCTATGCCG 58.179 43.478 0.00 0.00 0.00 5.69
617 625 2.285834 GCTATGCCGAATCTGTTGTTCG 60.286 50.000 1.61 1.61 45.83 3.95
912 927 9.520204 CTAATCATGTTTTGTGTTTTCAGTTCT 57.480 29.630 0.00 0.00 0.00 3.01
1030 1046 3.330720 CTCCCTTGGAAGGCCGGT 61.331 66.667 1.90 0.00 45.10 5.28
1070 1086 2.609825 CAGTGAACGAGCTGCTGTT 58.390 52.632 7.01 11.88 0.00 3.16
1184 1200 2.280524 CCCCGACAACGTCTGCAA 60.281 61.111 0.00 0.00 37.88 4.08
1370 1392 4.475919 TCTCACCTAGGGATCATCATCA 57.524 45.455 14.81 0.00 0.00 3.07
1459 1481 7.805071 CACATCTCTTTTGGTTGACTGAATTAC 59.195 37.037 0.00 0.00 0.00 1.89
1529 1551 0.667487 CGAAGCGCTCTTGTTCCTCA 60.667 55.000 12.06 0.00 31.48 3.86
2015 2109 5.646360 GGCTTCTGTGTGCTAATTAAACCTA 59.354 40.000 0.00 0.00 0.00 3.08
2176 2335 4.150980 GCCAAATGAATGTGTCAACATGTG 59.849 41.667 0.00 0.00 46.58 3.21
2191 2350 2.572104 ACATGTGTCTCCTTAGGGGTTC 59.428 50.000 0.00 0.00 36.25 3.62
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
101 103 6.423182 TGTGACCTATTTGGGGAGATAAAAG 58.577 40.000 0.00 0.0 41.11 2.27
367 372 2.526304 TTCAGACCTGTCCTTGAACG 57.474 50.000 0.00 0.0 0.00 3.95
420 425 7.414540 GCCACTTCTTAAATCTCGTTTCATCAT 60.415 37.037 0.00 0.0 0.00 2.45
434 439 4.727507 TTTTGCACAGCCACTTCTTAAA 57.272 36.364 0.00 0.0 0.00 1.52
549 557 0.107456 CACTGACCAAGTCCTGCAGT 59.893 55.000 13.81 0.0 40.17 4.40
604 612 2.412089 CCCGAACTCGAACAACAGATTC 59.588 50.000 0.00 0.0 43.02 2.52
617 625 6.746120 TCTAATATTCAACTAGCCCGAACTC 58.254 40.000 0.00 0.0 0.00 3.01
912 927 4.956700 CACACCAGGTTCTCCTAAGATAGA 59.043 45.833 0.00 0.0 43.07 1.98
1184 1200 7.615582 TGCTACGTATTGTTGTAGTAGTAGT 57.384 36.000 0.00 0.0 40.13 2.73
1370 1392 7.405292 TGAAAGATTTAGAAGATGGTGATGGT 58.595 34.615 0.00 0.0 0.00 3.55
1529 1551 1.745087 GATGTCGCCCATGATGTTTGT 59.255 47.619 0.00 0.0 32.56 2.83
2176 2335 5.709164 GGTTTAAAAGAACCCCTAAGGAGAC 59.291 44.000 0.00 0.0 42.63 3.36
2191 2350 7.305474 ACAGTAGATCATTTGCGGTTTAAAAG 58.695 34.615 0.00 0.0 0.00 2.27


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.