Multiple sequence alignment - TraesCS5A01G324800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G324800 chr5A 100.000 2772 0 0 1 2772 535747891 535745120 0.000000e+00 5120.0
1 TraesCS5A01G324800 chr5A 99.747 2772 6 1 1 2772 535756982 535754212 0.000000e+00 5079.0
2 TraesCS5A01G324800 chr5A 91.667 2088 145 19 691 2770 658879950 658877884 0.000000e+00 2865.0
3 TraesCS5A01G324800 chr5A 93.247 696 45 2 2 695 658893833 658893138 0.000000e+00 1024.0
4 TraesCS5A01G324800 chrUn 100.000 394 0 0 443 836 479448142 479448535 0.000000e+00 728.0
5 TraesCS5A01G324800 chrUn 83.523 176 28 1 11 185 352740237 352740412 2.210000e-36 163.0
6 TraesCS5A01G324800 chrUn 83.523 176 28 1 11 185 386228666 386228491 2.210000e-36 163.0
7 TraesCS5A01G324800 chr7B 86.074 517 68 4 295 809 122724357 122724871 1.120000e-153 553.0
8 TraesCS5A01G324800 chr7B 80.931 451 84 2 1532 1982 122727129 122727577 3.400000e-94 355.0
9 TraesCS5A01G324800 chr1B 87.764 474 57 1 340 812 565899564 565899091 1.120000e-153 553.0
10 TraesCS5A01G324800 chr1B 83.002 453 73 4 1532 1982 565898434 565897984 9.240000e-110 407.0
11 TraesCS5A01G324800 chr6B 86.019 515 66 6 295 808 643631562 643632071 5.220000e-152 547.0
12 TraesCS5A01G324800 chr2D 83.047 466 78 1 342 806 471444259 471443794 3.300000e-114 422.0
13 TraesCS5A01G324800 chr2D 82.869 467 78 2 341 806 534513539 534513074 4.270000e-113 418.0
14 TraesCS5A01G324800 chr2D 81.070 243 45 1 953 1194 471443680 471443438 2.820000e-45 193.0
15 TraesCS5A01G324800 chr3D 82.692 468 77 4 341 806 561028260 561027795 1.990000e-111 412.0
16 TraesCS5A01G324800 chr1A 74.579 594 118 24 954 1524 21633908 21633325 2.150000e-56 230.0
17 TraesCS5A01G324800 chr1A 74.227 582 129 14 954 1519 573955018 573955594 9.990000e-55 224.0
18 TraesCS5A01G324800 chr4B 83.523 176 28 1 11 185 19788570 19788395 2.210000e-36 163.0
19 TraesCS5A01G324800 chr4B 83.523 176 28 1 11 185 19833784 19833609 2.210000e-36 163.0
20 TraesCS5A01G324800 chr4B 84.884 86 13 0 953 1038 633918660 633918745 1.370000e-13 87.9
21 TraesCS5A01G324800 chr5B 86.517 89 12 0 953 1041 79786558 79786470 6.320000e-17 99.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G324800 chr5A 535745120 535747891 2771 True 5120.0 5120 100.0000 1 2772 1 chr5A.!!$R1 2771
1 TraesCS5A01G324800 chr5A 535754212 535756982 2770 True 5079.0 5079 99.7470 1 2772 1 chr5A.!!$R2 2771
2 TraesCS5A01G324800 chr5A 658877884 658879950 2066 True 2865.0 2865 91.6670 691 2770 1 chr5A.!!$R3 2079
3 TraesCS5A01G324800 chr5A 658893138 658893833 695 True 1024.0 1024 93.2470 2 695 1 chr5A.!!$R4 693
4 TraesCS5A01G324800 chr7B 122724357 122727577 3220 False 454.0 553 83.5025 295 1982 2 chr7B.!!$F1 1687
5 TraesCS5A01G324800 chr1B 565897984 565899564 1580 True 480.0 553 85.3830 340 1982 2 chr1B.!!$R1 1642
6 TraesCS5A01G324800 chr6B 643631562 643632071 509 False 547.0 547 86.0190 295 808 1 chr6B.!!$F1 513
7 TraesCS5A01G324800 chr2D 471443438 471444259 821 True 307.5 422 82.0585 342 1194 2 chr2D.!!$R2 852
8 TraesCS5A01G324800 chr1A 21633325 21633908 583 True 230.0 230 74.5790 954 1524 1 chr1A.!!$R1 570
9 TraesCS5A01G324800 chr1A 573955018 573955594 576 False 224.0 224 74.2270 954 1519 1 chr1A.!!$F1 565

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
26 27 8.718102 GTACAGAACAAACCTGTATGATATGT 57.282 34.615 0.0 0.0 45.44 2.29 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2152 3810 2.047274 GAACCACGGCTGCTGCTA 60.047 61.111 15.64 0.0 39.59 3.49 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 8.718102 GTACAGAACAAACCTGTATGATATGT 57.282 34.615 0.0 0.0 45.44 2.29
2152 3810 7.750903 GCGCTAAAACTGATAACTGAATTTTCT 59.249 33.333 0.0 0.0 0.00 2.52
2498 4159 2.423373 CCATTCCCATCCCGACTTTGAT 60.423 50.000 0.0 0.0 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 1.271934 TCCGACAAATAACCCGAACGA 59.728 47.619 0.00 0.0 0.00 3.85
2152 3810 2.047274 GAACCACGGCTGCTGCTA 60.047 61.111 15.64 0.0 39.59 3.49


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.