Multiple sequence alignment - TraesCS5A01G319100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G319100 chr5A 100.000 3230 0 0 1 3230 530200510 530197281 0 5965
1 TraesCS5A01G319100 chr5A 97.531 3240 67 10 1 3230 634750353 634753589 0 5528
2 TraesCS5A01G319100 chr5A 97.221 3239 74 10 1 3230 133825023 133828254 0 5469
3 TraesCS5A01G319100 chr5A 97.222 3240 73 7 1 3230 345655807 345652575 0 5469
4 TraesCS5A01G319100 chr5A 97.759 1294 18 4 1948 3230 5789418 5788125 0 2218
5 TraesCS5A01G319100 chr2A 97.437 3239 66 8 1 3230 55071915 55068685 0 5505
6 TraesCS5A01G319100 chr1A 97.346 3240 75 5 1 3230 7953685 7956923 0 5496
7 TraesCS5A01G319100 chr1A 97.192 3241 73 8 1 3230 539845525 539842292 0 5465
8 TraesCS5A01G319100 chr1A 96.685 3047 58 10 215 3230 443861296 443864330 0 5027
9 TraesCS5A01G319100 chr6A 97.130 3240 78 5 1 3230 436396373 436399607 0 5454
10 TraesCS5A01G319100 chr7A 97.067 3239 76 6 1 3230 493521863 493525091 0 5437
11 TraesCS5A01G319100 chr7A 96.914 3240 85 5 1 3230 578426613 578423379 0 5415
12 TraesCS5A01G319100 chr4B 96.761 3026 69 8 215 3230 113843168 113846174 0 5018
13 TraesCS5A01G319100 chr4B 97.363 1858 37 6 1384 3230 598970136 598971992 0 3149
14 TraesCS5A01G319100 chr4A 96.619 3046 63 8 215 3230 713777008 713780043 0 5018
15 TraesCS5A01G319100 chr4A 96.619 3046 62 9 215 3230 655504904 655507938 0 5016


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G319100 chr5A 530197281 530200510 3229 True 5965 5965 100.000 1 3230 1 chr5A.!!$R3 3229
1 TraesCS5A01G319100 chr5A 634750353 634753589 3236 False 5528 5528 97.531 1 3230 1 chr5A.!!$F2 3229
2 TraesCS5A01G319100 chr5A 133825023 133828254 3231 False 5469 5469 97.221 1 3230 1 chr5A.!!$F1 3229
3 TraesCS5A01G319100 chr5A 345652575 345655807 3232 True 5469 5469 97.222 1 3230 1 chr5A.!!$R2 3229
4 TraesCS5A01G319100 chr5A 5788125 5789418 1293 True 2218 2218 97.759 1948 3230 1 chr5A.!!$R1 1282
5 TraesCS5A01G319100 chr2A 55068685 55071915 3230 True 5505 5505 97.437 1 3230 1 chr2A.!!$R1 3229
6 TraesCS5A01G319100 chr1A 7953685 7956923 3238 False 5496 5496 97.346 1 3230 1 chr1A.!!$F1 3229
7 TraesCS5A01G319100 chr1A 539842292 539845525 3233 True 5465 5465 97.192 1 3230 1 chr1A.!!$R1 3229
8 TraesCS5A01G319100 chr1A 443861296 443864330 3034 False 5027 5027 96.685 215 3230 1 chr1A.!!$F2 3015
9 TraesCS5A01G319100 chr6A 436396373 436399607 3234 False 5454 5454 97.130 1 3230 1 chr6A.!!$F1 3229
10 TraesCS5A01G319100 chr7A 493521863 493525091 3228 False 5437 5437 97.067 1 3230 1 chr7A.!!$F1 3229
11 TraesCS5A01G319100 chr7A 578423379 578426613 3234 True 5415 5415 96.914 1 3230 1 chr7A.!!$R1 3229
12 TraesCS5A01G319100 chr4B 113843168 113846174 3006 False 5018 5018 96.761 215 3230 1 chr4B.!!$F1 3015
13 TraesCS5A01G319100 chr4B 598970136 598971992 1856 False 3149 3149 97.363 1384 3230 1 chr4B.!!$F2 1846
14 TraesCS5A01G319100 chr4A 713777008 713780043 3035 False 5018 5018 96.619 215 3230 1 chr4A.!!$F2 3015
15 TraesCS5A01G319100 chr4A 655504904 655507938 3034 False 5016 5016 96.619 215 3230 1 chr4A.!!$F1 3015

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
689 722 1.701847 AGGACAAGGTCAAGCATGAGT 59.298 47.619 0.0 0.0 35.88 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2395 2443 0.837691 ACCACATCTCCACCAGAGCA 60.838 55.0 0.0 0.0 42.9 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
82 83 5.479306 GTGTACCTGATAGTGTTGTCACAT 58.521 41.667 1.36 0.00 46.01 3.21
472 505 6.622679 GCATGCTTGTTTAGTGCACTTACATA 60.623 38.462 27.06 17.07 39.63 2.29
582 615 8.469200 TCCAAATGCTTTCCTTTATTGATACAG 58.531 33.333 0.00 0.00 0.00 2.74
689 722 1.701847 AGGACAAGGTCAAGCATGAGT 59.298 47.619 0.00 0.00 35.88 3.41
986 1019 7.068686 AGAAGGTTAGGGCTAGAAATATCAC 57.931 40.000 0.00 0.00 0.00 3.06
2395 2443 4.458256 TCTAATGGATGGTGAATGGCAT 57.542 40.909 0.00 0.00 0.00 4.40
2537 2587 3.128068 GGAAACCTGTTTGTCGAACAAGT 59.872 43.478 7.08 4.40 46.99 3.16
2607 2657 2.158928 ACACAGCACACATTTTTGCCAT 60.159 40.909 0.00 0.00 39.75 4.40
3031 3090 3.157217 ATGATCGGCTCACTCGGGC 62.157 63.158 0.00 0.00 36.48 6.13
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
82 83 9.996554 CAATGGTCTACAGTATATGATTGGTAA 57.003 33.333 0.00 0.00 0.00 2.85
129 130 4.699637 TGTGGTAAATCTGACAACGTCTT 58.300 39.130 0.00 0.00 33.15 3.01
285 286 8.539544 ACAAACCCTAATTAATAAGCAAGCAAT 58.460 29.630 0.00 0.00 0.00 3.56
582 615 6.096846 ACAGGGATAAAGTAAAATGATGCACC 59.903 38.462 0.00 0.00 0.00 5.01
745 778 9.102757 CAGTTCACTTAGCATATTAAGACACAT 57.897 33.333 1.92 0.00 35.20 3.21
769 802 5.913514 GCTTATTCAGATTGCAGCAATACAG 59.086 40.000 20.90 13.06 33.90 2.74
810 843 4.347000 AGGTAAGGAAGACTAACAGCACAA 59.653 41.667 0.00 0.00 0.00 3.33
887 920 4.383335 GGTGAATGTTTGGAATGCATGGAT 60.383 41.667 0.00 0.00 0.00 3.41
2395 2443 0.837691 ACCACATCTCCACCAGAGCA 60.838 55.000 0.00 0.00 42.90 4.26
3031 3090 6.114187 TGGTGGTTCTATATAAGATGGCTG 57.886 41.667 0.00 0.00 33.05 4.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.