Multiple sequence alignment - TraesCS5A01G311200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G311200 chr5A 100.000 2357 0 0 1 2357 522984866 522987222 0 4353
1 TraesCS5A01G311200 chr1A 98.473 2358 33 3 1 2357 491377763 491380118 0 4152
2 TraesCS5A01G311200 chr2A 98.387 2356 35 3 4 2357 41620088 41617734 0 4137
3 TraesCS5A01G311200 chr2B 98.217 2355 40 2 4 2357 721362371 721360018 0 4115
4 TraesCS5A01G311200 chr1B 98.135 2359 42 2 1 2357 636803886 636806244 0 4111
5 TraesCS5A01G311200 chr1B 98.239 1987 33 2 373 2357 664798171 664796185 0 3474
6 TraesCS5A01G311200 chr1B 97.727 660 15 0 1 660 659750630 659751289 0 1136
7 TraesCS5A01G311200 chr5B 98.498 2330 34 1 29 2357 375732632 375730303 0 4108
8 TraesCS5A01G311200 chr5B 98.089 2355 43 2 4 2357 606865442 606863089 0 4098
9 TraesCS5A01G311200 chr5B 97.668 2358 52 3 1 2357 503878169 503880524 0 4047
10 TraesCS5A01G311200 chr6B 97.880 2358 43 5 4 2357 675570298 675572652 0 4071


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G311200 chr5A 522984866 522987222 2356 False 4353 4353 100.000 1 2357 1 chr5A.!!$F1 2356
1 TraesCS5A01G311200 chr1A 491377763 491380118 2355 False 4152 4152 98.473 1 2357 1 chr1A.!!$F1 2356
2 TraesCS5A01G311200 chr2A 41617734 41620088 2354 True 4137 4137 98.387 4 2357 1 chr2A.!!$R1 2353
3 TraesCS5A01G311200 chr2B 721360018 721362371 2353 True 4115 4115 98.217 4 2357 1 chr2B.!!$R1 2353
4 TraesCS5A01G311200 chr1B 636803886 636806244 2358 False 4111 4111 98.135 1 2357 1 chr1B.!!$F1 2356
5 TraesCS5A01G311200 chr1B 664796185 664798171 1986 True 3474 3474 98.239 373 2357 1 chr1B.!!$R1 1984
6 TraesCS5A01G311200 chr1B 659750630 659751289 659 False 1136 1136 97.727 1 660 1 chr1B.!!$F2 659
7 TraesCS5A01G311200 chr5B 375730303 375732632 2329 True 4108 4108 98.498 29 2357 1 chr5B.!!$R1 2328
8 TraesCS5A01G311200 chr5B 606863089 606865442 2353 True 4098 4098 98.089 4 2357 1 chr5B.!!$R2 2353
9 TraesCS5A01G311200 chr5B 503878169 503880524 2355 False 4047 4047 97.668 1 2357 1 chr5B.!!$F1 2356
10 TraesCS5A01G311200 chr6B 675570298 675572652 2354 False 4071 4071 97.880 4 2357 1 chr6B.!!$F1 2353

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
496 500 1.215655 GCGCGGTGATATGGACACTC 61.216 60.0 8.83 0.0 38.2 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1811 1823 1.208052 GGCAAGAGTACTGCATCCTCA 59.792 52.381 0.0 0.0 0.0 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
331 335 1.598882 TGCGGTGTGCTAATTTCACA 58.401 45.000 8.57 8.57 46.63 3.58
496 500 1.215655 GCGCGGTGATATGGACACTC 61.216 60.000 8.83 0.00 38.20 3.51
513 517 2.041701 ACTCATGCCTGCTTTTGGTTT 58.958 42.857 0.00 0.00 0.00 3.27
582 586 6.025749 TCTCTGTTCTCGCTTATTTTCTCA 57.974 37.500 0.00 0.00 0.00 3.27
616 620 6.716934 TCGTCTGAGCCTATAAAAGAAGAT 57.283 37.500 0.00 0.00 0.00 2.40
1158 1165 9.816354 GAGCAAGAGAGAGAGTTAAAAGAATAT 57.184 33.333 0.00 0.00 0.00 1.28
1690 1702 7.551262 TGCAAGTACATCTGAATTAAACGGTAT 59.449 33.333 0.00 0.00 0.00 2.73
1811 1823 3.077359 CGATGAAGAACTCTTGCCCTTT 58.923 45.455 0.00 0.00 36.11 3.11
1999 2011 3.181434 ACAACCTTCTTCCACCTTGCATA 60.181 43.478 0.00 0.00 0.00 3.14
2044 2056 3.379452 CCTCCTCATAGGTCCTTTCAGT 58.621 50.000 0.00 0.00 36.53 3.41
2045 2057 3.777522 CCTCCTCATAGGTCCTTTCAGTT 59.222 47.826 0.00 0.00 36.53 3.16
2116 2128 1.391933 CCGGTGAGATCGTCCCATGA 61.392 60.000 0.00 0.00 0.00 3.07
2129 2141 7.674348 AGATCGTCCCATGAAACTATCCTATTA 59.326 37.037 0.00 0.00 0.00 0.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
331 335 1.526917 AGTTTGCAACAGCGAGCCT 60.527 52.632 0.00 0.00 0.00 4.58
496 500 2.563702 ACAAAACCAAAAGCAGGCATG 58.436 42.857 0.00 0.00 0.00 4.06
582 586 3.389329 AGGCTCAGACGATTAATGATGGT 59.611 43.478 0.00 0.00 0.00 3.55
1158 1165 3.883462 CGGTGTTGCTCCGCATAA 58.117 55.556 0.00 0.00 41.48 1.90
1183 1193 6.667848 TCCCTATTTTTCTTTCCCATTTCCTC 59.332 38.462 0.00 0.00 0.00 3.71
1203 1213 2.119655 GCGACGAGCCTCTTCCCTA 61.120 63.158 0.00 0.00 40.81 3.53
1690 1702 9.781633 TGTAGTTTTTAAGCTGTATTCCAGTTA 57.218 29.630 0.00 0.00 43.55 2.24
1811 1823 1.208052 GGCAAGAGTACTGCATCCTCA 59.792 52.381 0.00 0.00 0.00 3.86
1999 2011 6.925718 GGTACGTAAAGAACTTCTTAGGTTGT 59.074 38.462 4.41 3.19 35.27 3.32
2044 2056 3.055675 CCAATTACGTAGGTCTGGGTGAA 60.056 47.826 0.00 0.00 0.00 3.18
2045 2057 2.498481 CCAATTACGTAGGTCTGGGTGA 59.502 50.000 0.00 0.00 0.00 4.02
2129 2141 4.803329 AGCTACCAATTTCAGGATGGAT 57.197 40.909 0.00 0.00 37.66 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.