Multiple sequence alignment - TraesCS5A01G271000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G271000 chr5A 100.000 2923 0 0 1 2923 481679636 481676714 0 5398
1 TraesCS5A01G271000 chr5A 98.291 2926 46 3 1 2923 222619549 222616625 0 5123
2 TraesCS5A01G271000 chr7A 97.984 2926 55 3 1 2923 601994551 601997475 0 5073
3 TraesCS5A01G271000 chr1A 97.744 2926 61 4 1 2923 589492198 589495121 0 5033
4 TraesCS5A01G271000 chr1A 97.785 2167 44 3 760 2923 517627422 517625257 0 3733
5 TraesCS5A01G271000 chr3A 97.369 2927 56 9 1 2923 90368835 90371744 0 4959
6 TraesCS5A01G271000 chr3A 96.791 2929 86 4 1 2923 691676636 691679562 0 4881
7 TraesCS5A01G271000 chr1D 97.098 2929 77 5 1 2923 401167203 401164277 0 4931
8 TraesCS5A01G271000 chr6B 95.118 2929 136 4 1 2923 637009107 637006180 0 4610
9 TraesCS5A01G271000 chr7B 94.401 2929 154 7 1 2923 670086874 670089798 0 4492


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G271000 chr5A 481676714 481679636 2922 True 5398 5398 100.000 1 2923 1 chr5A.!!$R2 2922
1 TraesCS5A01G271000 chr5A 222616625 222619549 2924 True 5123 5123 98.291 1 2923 1 chr5A.!!$R1 2922
2 TraesCS5A01G271000 chr7A 601994551 601997475 2924 False 5073 5073 97.984 1 2923 1 chr7A.!!$F1 2922
3 TraesCS5A01G271000 chr1A 589492198 589495121 2923 False 5033 5033 97.744 1 2923 1 chr1A.!!$F1 2922
4 TraesCS5A01G271000 chr1A 517625257 517627422 2165 True 3733 3733 97.785 760 2923 1 chr1A.!!$R1 2163
5 TraesCS5A01G271000 chr3A 90368835 90371744 2909 False 4959 4959 97.369 1 2923 1 chr3A.!!$F1 2922
6 TraesCS5A01G271000 chr3A 691676636 691679562 2926 False 4881 4881 96.791 1 2923 1 chr3A.!!$F2 2922
7 TraesCS5A01G271000 chr1D 401164277 401167203 2926 True 4931 4931 97.098 1 2923 1 chr1D.!!$R1 2922
8 TraesCS5A01G271000 chr6B 637006180 637009107 2927 True 4610 4610 95.118 1 2923 1 chr6B.!!$R1 2922
9 TraesCS5A01G271000 chr7B 670086874 670089798 2924 False 4492 4492 94.401 1 2923 1 chr7B.!!$F1 2922

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
282 283 1.257743 TCAAGCTTACTCGGTGCTCT 58.742 50.0 0.0 0.0 35.85 4.09 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2038 2047 0.31904 CGATCACCATCAGTAGCCCG 60.319 60.0 0.0 0.0 0.0 6.13 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
282 283 1.257743 TCAAGCTTACTCGGTGCTCT 58.742 50.000 0.00 0.0 35.85 4.09
730 734 2.031012 CTGAGCACACCTTCGCCA 59.969 61.111 0.00 0.0 0.00 5.69
1070 1074 3.130516 AGCGATCGAATGTTGTTCCTAGA 59.869 43.478 21.57 0.0 0.00 2.43
1173 1177 8.588290 TTGTTAATAGGTTTGATGTGGCTAAT 57.412 30.769 0.00 0.0 0.00 1.73
1204 1208 3.646162 TGTTCCTTCTAGAGGTGCTTCAA 59.354 43.478 0.71 0.0 46.39 2.69
1399 1404 6.961359 CACTTTTGTGTATGATAACCTCGA 57.039 37.500 0.00 0.0 44.94 4.04
1591 1596 7.201732 GCAGCACACTGTTAATCCTATTTACAT 60.202 37.037 0.00 0.0 46.30 2.29
1979 1986 9.294030 CATGCTTTAGAAAATTCGCTTATTCTT 57.706 29.630 0.00 0.0 34.24 2.52
2038 2047 8.788325 TTATAAGCAAAGAAGTAAGAAGGGAC 57.212 34.615 0.00 0.0 0.00 4.46
2336 2345 4.699257 GGACATGAAGTTGAATGCTTCTCT 59.301 41.667 0.00 0.0 41.94 3.10
2358 2367 3.790126 AGGGCCAGATGGTTTTAATGTT 58.210 40.909 6.18 0.0 37.57 2.71
2482 2492 6.347696 ACAAACATTGCTCTCATTCCAAAAA 58.652 32.000 0.00 0.0 0.00 1.94
2648 2658 8.777865 TGAAGGTAGAAGAATTAGTGACAATG 57.222 34.615 0.00 0.0 0.00 2.82
2688 2698 6.532826 AGATTTCTCACTCTTTTGCTCTTCT 58.467 36.000 0.00 0.0 0.00 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
282 283 0.380378 GAAAACTTGCGTGTCTGGCA 59.620 50.000 0.00 0.00 38.93 4.92
420 421 2.416547 CGTTGAGATGTTGTGGATCCAC 59.583 50.000 33.97 33.97 46.33 4.02
730 734 3.176924 ACTGTACCCTCACTGACAGAT 57.823 47.619 10.08 0.00 41.51 2.90
1070 1074 6.431234 AGCTTTTGTAGAACGGATCAGATTTT 59.569 34.615 0.00 0.00 0.00 1.82
1204 1208 1.053264 CCACATAGCCAGAGCCCTCT 61.053 60.000 0.00 0.00 41.25 3.69
1591 1596 3.719924 ACAAGACAACGATCCAAACGTA 58.280 40.909 0.00 0.00 43.16 3.57
1979 1986 7.396339 TCAGTTTAGAGAGAGTTTGCATACCTA 59.604 37.037 3.47 0.00 0.00 3.08
2038 2047 0.319040 CGATCACCATCAGTAGCCCG 60.319 60.000 0.00 0.00 0.00 6.13
2336 2345 4.601406 ACATTAAAACCATCTGGCCCTA 57.399 40.909 0.00 0.00 39.32 3.53
2358 2367 7.775053 ATTCCAAGTAGCCAAATAAAACTCA 57.225 32.000 0.00 0.00 0.00 3.41
2482 2492 4.251103 AGGAACCTGAGGAACAAGTTTT 57.749 40.909 4.99 0.00 33.88 2.43
2648 2658 8.121708 GTGAGAAATCTCTTGAGCAATAATGAC 58.878 37.037 11.45 0.00 43.25 3.06
2688 2698 4.648762 TGAAAGCAAGGTGATTCCAAGAAA 59.351 37.500 0.00 0.00 39.02 2.52
2844 2854 3.268334 AGGCCTACCATTAATGACCACAA 59.732 43.478 17.23 0.00 39.06 3.33


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.