Multiple sequence alignment - TraesCS5A01G246100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G246100 chr5A 100.000 2267 0 0 1 2267 459479527 459477261 0.000000e+00 4187
1 TraesCS5A01G246100 chr5A 92.308 481 29 5 1782 2261 573792561 573793034 0.000000e+00 676
2 TraesCS5A01G246100 chr7A 93.301 2269 125 12 1 2267 201968648 201970891 0.000000e+00 3323
3 TraesCS5A01G246100 chr7A 89.477 1473 128 12 46 1511 735980090 735978638 0.000000e+00 1836
4 TraesCS5A01G246100 chr7A 92.181 486 32 3 1782 2267 118425634 118426113 0.000000e+00 682
5 TraesCS5A01G246100 chr4A 94.663 1649 82 5 615 2262 66536002 66537645 0.000000e+00 2553
6 TraesCS5A01G246100 chr3A 92.857 1764 118 6 1 1762 80569328 80571085 0.000000e+00 2553
7 TraesCS5A01G246100 chr3A 89.831 1770 120 27 1 1754 702488510 702486785 0.000000e+00 2217
8 TraesCS5A01G246100 chr3A 88.949 1656 124 17 39 1682 737723350 737721742 0.000000e+00 1989
9 TraesCS5A01G246100 chr3A 93.496 492 23 3 1782 2267 80571053 80571541 0.000000e+00 723
10 TraesCS5A01G246100 chr3A 92.276 492 25 4 1782 2267 700688860 700688376 0.000000e+00 686
11 TraesCS5A01G246100 chr2A 93.255 1616 101 7 1 1612 767478048 767476437 0.000000e+00 2374
12 TraesCS5A01G246100 chr6A 91.073 1770 111 18 1 1760 21600970 21602702 0.000000e+00 2350
13 TraesCS5A01G246100 chr6A 91.975 486 30 4 1782 2267 21602672 21603148 0.000000e+00 673
14 TraesCS5A01G246100 chr1A 93.338 1531 90 11 259 1785 514986899 514985377 0.000000e+00 2252
15 TraesCS5A01G246100 chr1A 93.152 1504 83 12 259 1754 514738132 514736641 0.000000e+00 2189
16 TraesCS5A01G246100 chr1A 96.095 922 34 2 865 1785 515251147 515250227 0.000000e+00 1502
17 TraesCS5A01G246100 chr1A 93.210 486 28 2 1782 2267 514736664 514736184 0.000000e+00 710
18 TraesCS5A01G246100 chr1A 93.004 486 30 2 1782 2267 514985284 514984803 0.000000e+00 706
19 TraesCS5A01G246100 chr1A 91.152 486 24 5 1782 2267 515250133 515249667 1.900000e-180 641
20 TraesCS5A01G246100 chr1A 86.912 489 27 14 1782 2267 564259047 564258593 4.320000e-142 514
21 TraesCS5A01G246100 chr1A 86.094 489 31 20 1782 2267 564252578 564253032 2.020000e-135 492
22 TraesCS5A01G246100 chr7D 90.041 492 34 5 1782 2262 39240835 39241322 6.880000e-175 623
23 TraesCS5A01G246100 chr7D 91.264 435 26 4 1782 2210 54727209 54726781 1.170000e-162 582
24 TraesCS5A01G246100 chr5D 90.042 472 32 5 1808 2267 41231405 41231873 4.170000e-167 597
25 TraesCS5A01G246100 chr1D 87.897 504 41 6 1782 2267 422275515 422276016 1.950000e-160 575
26 TraesCS5A01G246100 chr3D 87.800 500 40 7 1782 2267 2336628 2336136 1.180000e-157 566


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G246100 chr5A 459477261 459479527 2266 True 4187.0 4187 100.0000 1 2267 1 chr5A.!!$R1 2266
1 TraesCS5A01G246100 chr7A 201968648 201970891 2243 False 3323.0 3323 93.3010 1 2267 1 chr7A.!!$F2 2266
2 TraesCS5A01G246100 chr7A 735978638 735980090 1452 True 1836.0 1836 89.4770 46 1511 1 chr7A.!!$R1 1465
3 TraesCS5A01G246100 chr4A 66536002 66537645 1643 False 2553.0 2553 94.6630 615 2262 1 chr4A.!!$F1 1647
4 TraesCS5A01G246100 chr3A 702486785 702488510 1725 True 2217.0 2217 89.8310 1 1754 1 chr3A.!!$R2 1753
5 TraesCS5A01G246100 chr3A 737721742 737723350 1608 True 1989.0 1989 88.9490 39 1682 1 chr3A.!!$R3 1643
6 TraesCS5A01G246100 chr3A 80569328 80571541 2213 False 1638.0 2553 93.1765 1 2267 2 chr3A.!!$F1 2266
7 TraesCS5A01G246100 chr2A 767476437 767478048 1611 True 2374.0 2374 93.2550 1 1612 1 chr2A.!!$R1 1611
8 TraesCS5A01G246100 chr6A 21600970 21603148 2178 False 1511.5 2350 91.5240 1 2267 2 chr6A.!!$F1 2266
9 TraesCS5A01G246100 chr1A 514984803 514986899 2096 True 1479.0 2252 93.1710 259 2267 2 chr1A.!!$R3 2008
10 TraesCS5A01G246100 chr1A 514736184 514738132 1948 True 1449.5 2189 93.1810 259 2267 2 chr1A.!!$R2 2008
11 TraesCS5A01G246100 chr1A 515249667 515251147 1480 True 1071.5 1502 93.6235 865 2267 2 chr1A.!!$R4 1402
12 TraesCS5A01G246100 chr1D 422275515 422276016 501 False 575.0 575 87.8970 1782 2267 1 chr1D.!!$F1 485

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
172 177 0.674534 CCCTATAAAGAGCGCCTCGT 59.325 55.000 2.29 0.0 35.36 4.18 F
474 481 1.756950 CCTGTACAGGGCTCGCCTA 60.757 63.158 31.15 0.0 44.87 3.93 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1064 1088 0.535335 GGCGACCTGAATGTACTCCA 59.465 55.000 0.0 0.0 0.00 3.86 R
1867 2164 2.396157 GCGTTCCCTTTCGCCGATT 61.396 57.895 0.0 0.0 45.54 3.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
172 177 0.674534 CCCTATAAAGAGCGCCTCGT 59.325 55.000 2.29 0.0 35.36 4.18
229 234 2.685380 CCTTCTCCCCCTGTCGCT 60.685 66.667 0.00 0.0 0.00 4.93
311 318 4.555709 ACGCCCCAACTTGACGCA 62.556 61.111 0.00 0.0 0.00 5.24
410 417 2.188829 TCGTCGACGTTCCTGTGGT 61.189 57.895 34.40 0.0 40.80 4.16
474 481 1.756950 CCTGTACAGGGCTCGCCTA 60.757 63.158 31.15 0.0 44.87 3.93
1004 1028 4.429212 CGACCCGGACGACATGCA 62.429 66.667 0.73 0.0 0.00 3.96
1191 1224 3.681835 GTGCCCCTCGACGACAGT 61.682 66.667 0.00 0.0 0.00 3.55
1437 1480 8.872845 GTTGTTGAAGAATCAAGTGTTTGAATT 58.127 29.630 0.00 0.0 45.88 2.17
1738 1785 7.504922 TTGACATAATATTCGCAAAACAAGC 57.495 32.000 0.00 0.0 0.00 4.01
1867 2164 3.074369 TCGCTCCCGATCAAGCCA 61.074 61.111 6.25 0.0 38.82 4.75
1895 2192 2.671963 GGGAACGCTTTTCGGCCT 60.672 61.111 0.00 0.0 43.86 5.19
1897 2194 1.964373 GGAACGCTTTTCGGCCTCA 60.964 57.895 0.00 0.0 43.86 3.86
2039 2342 2.185387 GGTGGGACTAAAGGTAGAGCA 58.815 52.381 0.00 0.0 0.00 4.26
2262 2590 1.885163 CGTTTAGTCCCACCTCGCCT 61.885 60.000 0.00 0.0 0.00 5.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
258 264 0.947180 GGAAAAGGTACAGCGCGTGA 60.947 55.000 8.43 0.00 0.00 4.35
259 265 0.949105 AGGAAAAGGTACAGCGCGTG 60.949 55.000 8.43 7.60 0.00 5.34
260 266 0.669625 GAGGAAAAGGTACAGCGCGT 60.670 55.000 8.43 5.88 0.00 6.01
261 267 0.389948 AGAGGAAAAGGTACAGCGCG 60.390 55.000 0.00 0.00 0.00 6.86
262 268 1.360820 GAGAGGAAAAGGTACAGCGC 58.639 55.000 0.00 0.00 0.00 5.92
266 273 0.245539 CGGCGAGAGGAAAAGGTACA 59.754 55.000 0.00 0.00 0.00 2.90
311 318 2.841988 GCTCCTCCGCCTCCTCAT 60.842 66.667 0.00 0.00 0.00 2.90
395 402 2.028484 GCACCACAGGAACGTCGA 59.972 61.111 0.00 0.00 0.00 4.20
474 481 3.532155 GTGAGCTCCTCCGGCGAT 61.532 66.667 9.30 0.00 34.52 4.58
540 547 4.498520 CGGCGCAGGTGATCGTCT 62.499 66.667 10.83 0.00 0.00 4.18
842 854 4.524318 CGTTCCTGCCCGCCGTAT 62.524 66.667 0.00 0.00 0.00 3.06
944 968 2.597818 TACTCCGCCACCAATGCCA 61.598 57.895 0.00 0.00 0.00 4.92
1004 1028 3.775654 GCGCTGTCAGGTAGCCCT 61.776 66.667 0.00 0.00 44.02 5.19
1059 1083 3.056821 CGACCTGAATGTACTCCAGAACA 60.057 47.826 10.03 0.00 0.00 3.18
1064 1088 0.535335 GGCGACCTGAATGTACTCCA 59.465 55.000 0.00 0.00 0.00 3.86
1191 1224 2.179267 CTGTCGTCGCTGCTGCTA 59.821 61.111 14.03 0.00 36.97 3.49
1867 2164 2.396157 GCGTTCCCTTTCGCCGATT 61.396 57.895 0.00 0.00 45.54 3.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.