Multiple sequence alignment - TraesCS5A01G218800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G218800 chr5A 100.000 2333 0 0 1 2333 436306703 436304371 0.000000e+00 4309
1 TraesCS5A01G218800 chr5A 92.510 1936 112 20 406 2333 645415758 645417668 0.000000e+00 2741
2 TraesCS5A01G218800 chr5A 89.600 250 22 2 13 258 645415100 645415349 4.840000e-82 315
3 TraesCS5A01G218800 chr2A 94.477 2372 91 11 1 2333 166853989 166851619 0.000000e+00 3618
4 TraesCS5A01G218800 chr2A 92.626 1546 103 6 26 1567 613268971 613267433 0.000000e+00 2213
5 TraesCS5A01G218800 chr2A 83.390 2041 303 31 308 2331 239374249 239372228 0.000000e+00 1858
6 TraesCS5A01G218800 chr7A 93.061 2349 128 13 15 2333 461793746 461791403 0.000000e+00 3402
7 TraesCS5A01G218800 chr7A 92.992 2283 111 14 89 2333 610920331 610922602 0.000000e+00 3284
8 TraesCS5A01G218800 chr7D 91.327 2329 153 21 13 2311 594139768 594142077 0.000000e+00 3136
9 TraesCS5A01G218800 chr7D 86.095 2366 242 45 13 2325 412230145 412232476 0.000000e+00 2466
10 TraesCS5A01G218800 chr6D 92.095 2100 111 16 13 2096 139290680 139292740 0.000000e+00 2907
11 TraesCS5A01G218800 chr1D 88.784 2327 200 20 15 2333 281370419 281372692 0.000000e+00 2795
12 TraesCS5A01G218800 chr1D 83.643 2311 305 47 13 2295 493226604 493228869 0.000000e+00 2106
13 TraesCS5A01G218800 chr5D 87.585 2344 234 33 13 2333 137050103 137052412 0.000000e+00 2663
14 TraesCS5A01G218800 chr5D 85.651 1136 138 22 1209 2333 531882705 531883826 0.000000e+00 1171
15 TraesCS5A01G218800 chr3D 94.042 1561 81 10 13 1567 492007106 492005552 0.000000e+00 2357
16 TraesCS5A01G218800 chr2D 84.720 2356 301 38 15 2333 553767477 553765144 0.000000e+00 2302
17 TraesCS5A01G218800 chr2D 94.198 879 28 7 1472 2330 562894537 562895412 0.000000e+00 1319


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G218800 chr5A 436304371 436306703 2332 True 4309 4309 100.000 1 2333 1 chr5A.!!$R1 2332
1 TraesCS5A01G218800 chr5A 645415100 645417668 2568 False 1528 2741 91.055 13 2333 2 chr5A.!!$F1 2320
2 TraesCS5A01G218800 chr2A 166851619 166853989 2370 True 3618 3618 94.477 1 2333 1 chr2A.!!$R1 2332
3 TraesCS5A01G218800 chr2A 613267433 613268971 1538 True 2213 2213 92.626 26 1567 1 chr2A.!!$R3 1541
4 TraesCS5A01G218800 chr2A 239372228 239374249 2021 True 1858 1858 83.390 308 2331 1 chr2A.!!$R2 2023
5 TraesCS5A01G218800 chr7A 461791403 461793746 2343 True 3402 3402 93.061 15 2333 1 chr7A.!!$R1 2318
6 TraesCS5A01G218800 chr7A 610920331 610922602 2271 False 3284 3284 92.992 89 2333 1 chr7A.!!$F1 2244
7 TraesCS5A01G218800 chr7D 594139768 594142077 2309 False 3136 3136 91.327 13 2311 1 chr7D.!!$F2 2298
8 TraesCS5A01G218800 chr7D 412230145 412232476 2331 False 2466 2466 86.095 13 2325 1 chr7D.!!$F1 2312
9 TraesCS5A01G218800 chr6D 139290680 139292740 2060 False 2907 2907 92.095 13 2096 1 chr6D.!!$F1 2083
10 TraesCS5A01G218800 chr1D 281370419 281372692 2273 False 2795 2795 88.784 15 2333 1 chr1D.!!$F1 2318
11 TraesCS5A01G218800 chr1D 493226604 493228869 2265 False 2106 2106 83.643 13 2295 1 chr1D.!!$F2 2282
12 TraesCS5A01G218800 chr5D 137050103 137052412 2309 False 2663 2663 87.585 13 2333 1 chr5D.!!$F1 2320
13 TraesCS5A01G218800 chr5D 531882705 531883826 1121 False 1171 1171 85.651 1209 2333 1 chr5D.!!$F2 1124
14 TraesCS5A01G218800 chr3D 492005552 492007106 1554 True 2357 2357 94.042 13 1567 1 chr3D.!!$R1 1554
15 TraesCS5A01G218800 chr2D 553765144 553767477 2333 True 2302 2302 84.720 15 2333 1 chr2D.!!$R1 2318
16 TraesCS5A01G218800 chr2D 562894537 562895412 875 False 1319 1319 94.198 1472 2330 1 chr2D.!!$F1 858

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
46 51 0.925466 CGTCTGTTTTTCGTCCACGT 59.075 50.0 0.0 0.0 40.8 4.49 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1567 1959 1.411977 TGCCATTGTGTTGAACCTTGG 59.588 47.619 0.0 0.0 34.45 3.61 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
43 47 1.928653 CGCGTCTGTTTTTCGTCCA 59.071 52.632 0.00 0.00 0.00 4.02
46 51 0.925466 CGTCTGTTTTTCGTCCACGT 59.075 50.000 0.00 0.00 40.80 4.49
132 141 2.601868 GCCTACTCCTCTCCCCGA 59.398 66.667 0.00 0.00 0.00 5.14
174 192 3.475575 CACCACCATTTTCCCCAAAAAG 58.524 45.455 0.00 0.00 40.09 2.27
175 193 2.441375 ACCACCATTTTCCCCAAAAAGG 59.559 45.455 0.96 0.96 43.31 3.11
177 200 2.106338 CACCATTTTCCCCAAAAAGGCT 59.894 45.455 2.19 0.00 42.01 4.58
379 452 2.920912 AACGGGCAAGGGAGTCGA 60.921 61.111 0.00 0.00 0.00 4.20
519 878 1.091771 CGCTCTACATGCTTGGGGTG 61.092 60.000 4.44 0.00 0.00 4.61
1094 1465 0.039437 GAAGAGGACGAGTGCGACAA 60.039 55.000 0.00 0.00 41.64 3.18
1307 1679 0.110238 GCGAGTTTCATGAGCGCAAA 60.110 50.000 21.31 0.00 46.19 3.68
1309 1681 2.236690 CGAGTTTCATGAGCGCAAAAG 58.763 47.619 11.47 0.00 0.00 2.27
1487 1860 1.115326 AAGCAAGCCGCCCTCTTTTT 61.115 50.000 0.00 0.00 44.04 1.94
1567 1959 8.422973 TTGCATGAAAACATTTTATAGGCATC 57.577 30.769 0.00 0.00 35.56 3.91
1800 2228 4.465512 CAAGCGTGGACGGCATGC 62.466 66.667 9.90 9.90 40.23 4.06
1902 2353 0.391661 GAGGCTTGATCTTGACGCCA 60.392 55.000 11.72 0.00 43.07 5.69
2007 2459 2.603173 CGAAAGAAGTGGCTCTTGCAAC 60.603 50.000 6.53 0.00 43.31 4.17
2068 2520 3.914984 CTTGTCGCCAAGGAAGAGA 57.085 52.632 0.00 0.00 43.62 3.10
2089 2541 2.086869 CCGTGGTTTGAGAAGATGCAT 58.913 47.619 0.00 0.00 0.00 3.96
2137 2591 0.882474 GATCTATGACGTCGAGGGGG 59.118 60.000 11.62 0.00 0.00 5.40
2204 2662 2.444624 CGATGGCGTGGTCGAACTG 61.445 63.158 0.33 0.00 40.11 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
11 12 3.732892 CGCGCGTCCATTTGGGTT 61.733 61.111 24.19 0.0 38.11 4.11
43 47 2.047274 CTGGAATGGGTCGCACGT 60.047 61.111 0.00 0.0 0.00 4.49
46 51 4.424711 GGCCTGGAATGGGTCGCA 62.425 66.667 0.00 0.0 0.00 5.10
247 294 3.003763 GGCGAGGGAGGTGAGGTT 61.004 66.667 0.00 0.0 0.00 3.50
379 452 3.330720 CCGGCCCTTCCTCTTGGT 61.331 66.667 0.00 0.0 34.23 3.67
519 878 0.960861 GGTTGTGCTGGCTAGGGTTC 60.961 60.000 0.00 0.0 0.00 3.62
570 932 2.357034 GGAAACGCTGACGAGCCA 60.357 61.111 0.00 0.0 42.91 4.75
837 1208 1.203994 ACGGACGACATTTCCTCGAAT 59.796 47.619 0.00 0.0 35.08 3.34
973 1344 0.901124 GCCTGATCGGGATCATAGCT 59.099 55.000 25.54 0.0 45.74 3.32
1094 1465 1.594331 GAACAAAGGCTCCACTTCGT 58.406 50.000 0.00 0.0 0.00 3.85
1307 1679 3.901222 CAAATTGGTAGGGTGGAAACCTT 59.099 43.478 0.00 0.0 39.54 3.50
1309 1681 3.006430 CACAAATTGGTAGGGTGGAAACC 59.994 47.826 0.00 0.0 0.00 3.27
1370 1742 4.650734 TGTTGCACTCTTGTTGGATCATA 58.349 39.130 0.00 0.0 0.00 2.15
1487 1860 5.066375 CGTAAAAGGATGATCTTGATGGCAA 59.934 40.000 0.00 0.0 0.00 4.52
1567 1959 1.411977 TGCCATTGTGTTGAACCTTGG 59.588 47.619 0.00 0.0 34.45 3.61
1800 2228 6.379703 TCCTCTCTTGAGTCCTTCTTATTCAG 59.620 42.308 0.00 0.0 38.61 3.02
1902 2353 2.227388 CGAACATCTTGGCTTGCTTCTT 59.773 45.455 0.00 0.0 0.00 2.52
2007 2459 2.192979 CCACCCCGGTCATCATGG 59.807 66.667 0.00 0.0 0.00 3.66
2068 2520 1.202758 TGCATCTTCTCAAACCACGGT 60.203 47.619 0.00 0.0 0.00 4.83
2089 2541 1.291184 CGAACTTGAGCATGTCGGCA 61.291 55.000 0.00 0.0 35.83 5.69
2169 2627 2.805546 GCGGCTCTCGTGGTCATA 59.194 61.111 0.00 0.0 41.72 2.15


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.