Multiple sequence alignment - TraesCS5A01G212700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G212700 chr5A 100.000 4598 0 0 1 4598 427854235 427849638 0.000000e+00 8492
1 TraesCS5A01G212700 chr5A 97.977 346 7 0 1 346 65997437 65997782 6.580000e-168 601
2 TraesCS5A01G212700 chr6A 98.761 4602 52 5 1 4598 517540475 517535875 0.000000e+00 8178
3 TraesCS5A01G212700 chr4A 98.458 4603 55 7 1 4598 679659900 679655309 0.000000e+00 8093
4 TraesCS5A01G212700 chr7D 97.969 2954 56 3 28 2978 83434474 83437426 0.000000e+00 5120
5 TraesCS5A01G212700 chr7D 97.663 2953 65 3 28 2978 292322600 292325550 0.000000e+00 5068
6 TraesCS5A01G212700 chr7D 94.908 1139 39 4 3000 4136 83451118 83452239 0.000000e+00 1764
7 TraesCS5A01G212700 chr7D 94.391 1141 42 6 3000 4136 292339363 292340485 0.000000e+00 1733
8 TraesCS5A01G212700 chr7D 93.357 843 38 6 3007 3848 86840439 86841264 0.000000e+00 1230
9 TraesCS5A01G212700 chr7D 98.030 203 4 0 4167 4369 83452237 83452439 2.040000e-93 353
10 TraesCS5A01G212700 chr7D 98.030 203 4 0 4167 4369 292340483 292340685 2.040000e-93 353
11 TraesCS5A01G212700 chrUn 97.868 2955 58 3 28 2978 19136336 19139289 0.000000e+00 5103
12 TraesCS5A01G212700 chrUn 94.825 1140 39 4 3000 4136 19153054 19154176 0.000000e+00 1760
13 TraesCS5A01G212700 chrUn 98.030 203 4 0 4167 4369 19154174 19154376 2.040000e-93 353
14 TraesCS5A01G212700 chrUn 95.545 202 7 1 4397 4598 19154374 19154573 5.740000e-84 322
15 TraesCS5A01G212700 chr4D 97.833 2953 58 6 28 2978 215025786 215022838 0.000000e+00 5094
16 TraesCS5A01G212700 chr4D 97.537 203 5 0 4167 4369 215007929 215007727 9.470000e-92 348
17 TraesCS5A01G212700 chr4D 95.545 202 7 1 4397 4598 215007729 215007530 5.740000e-84 322
18 TraesCS5A01G212700 chr2D 97.664 2954 64 4 28 2978 142216011 142218962 0.000000e+00 5068
19 TraesCS5A01G212700 chr2D 94.991 2216 100 7 342 2550 89876608 89874397 0.000000e+00 3467
20 TraesCS5A01G212700 chr2D 93.563 1134 52 9 3007 4136 203148265 203149381 0.000000e+00 1670
21 TraesCS5A01G212700 chr2D 98.522 203 3 0 4167 4369 142233833 142234035 4.370000e-95 359
22 TraesCS5A01G212700 chr2D 95.545 202 7 1 4397 4598 142234033 142234232 5.740000e-84 322
23 TraesCS5A01G212700 chr2A 95.309 2217 90 6 342 2550 89491533 89489323 0.000000e+00 3506
24 TraesCS5A01G212700 chr1D 95.452 1671 42 8 1316 2978 460574411 460572767 0.000000e+00 2634
25 TraesCS5A01G212700 chr1D 94.649 1140 41 4 3000 4136 460559281 460558159 0.000000e+00 1749
26 TraesCS5A01G212700 chr1D 86.395 588 54 18 3764 4327 416255158 416254573 1.820000e-173 619
27 TraesCS5A01G212700 chr1D 98.522 203 3 0 4167 4369 460558161 460557959 4.370000e-95 359
28 TraesCS5A01G212700 chr1D 95.545 202 7 1 4397 4598 460557961 460557762 5.740000e-84 322
29 TraesCS5A01G212700 chr1D 87.770 278 28 4 4325 4598 416254347 416254072 2.060000e-83 320
30 TraesCS5A01G212700 chr7A 87.992 1066 121 7 3071 4130 689301473 689302537 0.000000e+00 1253
31 TraesCS5A01G212700 chr5D 94.581 775 21 4 3366 4136 13284138 13284895 0.000000e+00 1179
32 TraesCS5A01G212700 chr5D 95.545 202 7 1 4397 4598 13285093 13285292 5.740000e-84 322
33 TraesCS5A01G212700 chr3D 94.318 528 12 3 3610 4136 46929638 46929128 0.000000e+00 793
34 TraesCS5A01G212700 chr3D 95.853 434 16 2 2545 2978 48644531 48644962 0.000000e+00 701
35 TraesCS5A01G212700 chr3D 95.545 202 7 1 4397 4598 46928927 46928728 5.740000e-84 322
36 TraesCS5A01G212700 chr3B 95.376 346 16 0 1 346 17319532 17319877 6.720000e-153 551
37 TraesCS5A01G212700 chr3B 93.353 346 23 0 1 346 679711656 679711311 3.170000e-141 512


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G212700 chr5A 427849638 427854235 4597 True 8492.000000 8492 100.000000 1 4598 1 chr5A.!!$R1 4597
1 TraesCS5A01G212700 chr6A 517535875 517540475 4600 True 8178.000000 8178 98.761000 1 4598 1 chr6A.!!$R1 4597
2 TraesCS5A01G212700 chr4A 679655309 679659900 4591 True 8093.000000 8093 98.458000 1 4598 1 chr4A.!!$R1 4597
3 TraesCS5A01G212700 chr7D 83434474 83437426 2952 False 5120.000000 5120 97.969000 28 2978 1 chr7D.!!$F1 2950
4 TraesCS5A01G212700 chr7D 292322600 292325550 2950 False 5068.000000 5068 97.663000 28 2978 1 chr7D.!!$F3 2950
5 TraesCS5A01G212700 chr7D 86840439 86841264 825 False 1230.000000 1230 93.357000 3007 3848 1 chr7D.!!$F2 841
6 TraesCS5A01G212700 chr7D 83451118 83452439 1321 False 1058.500000 1764 96.469000 3000 4369 2 chr7D.!!$F4 1369
7 TraesCS5A01G212700 chr7D 292339363 292340685 1322 False 1043.000000 1733 96.210500 3000 4369 2 chr7D.!!$F5 1369
8 TraesCS5A01G212700 chrUn 19136336 19139289 2953 False 5103.000000 5103 97.868000 28 2978 1 chrUn.!!$F1 2950
9 TraesCS5A01G212700 chrUn 19153054 19154573 1519 False 811.666667 1760 96.133333 3000 4598 3 chrUn.!!$F2 1598
10 TraesCS5A01G212700 chr4D 215022838 215025786 2948 True 5094.000000 5094 97.833000 28 2978 1 chr4D.!!$R1 2950
11 TraesCS5A01G212700 chr2D 142216011 142218962 2951 False 5068.000000 5068 97.664000 28 2978 1 chr2D.!!$F1 2950
12 TraesCS5A01G212700 chr2D 89874397 89876608 2211 True 3467.000000 3467 94.991000 342 2550 1 chr2D.!!$R1 2208
13 TraesCS5A01G212700 chr2D 203148265 203149381 1116 False 1670.000000 1670 93.563000 3007 4136 1 chr2D.!!$F2 1129
14 TraesCS5A01G212700 chr2A 89489323 89491533 2210 True 3506.000000 3506 95.309000 342 2550 1 chr2A.!!$R1 2208
15 TraesCS5A01G212700 chr1D 460572767 460574411 1644 True 2634.000000 2634 95.452000 1316 2978 1 chr1D.!!$R1 1662
16 TraesCS5A01G212700 chr1D 460557762 460559281 1519 True 810.000000 1749 96.238667 3000 4598 3 chr1D.!!$R3 1598
17 TraesCS5A01G212700 chr1D 416254072 416255158 1086 True 469.500000 619 87.082500 3764 4598 2 chr1D.!!$R2 834
18 TraesCS5A01G212700 chr7A 689301473 689302537 1064 False 1253.000000 1253 87.992000 3071 4130 1 chr7A.!!$F1 1059
19 TraesCS5A01G212700 chr5D 13284138 13285292 1154 False 750.500000 1179 95.063000 3366 4598 2 chr5D.!!$F1 1232
20 TraesCS5A01G212700 chr3D 46928728 46929638 910 True 557.500000 793 94.931500 3610 4598 2 chr3D.!!$R1 988

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
976 990 1.446792 CTGCTTGATCGGCGTCAGT 60.447 57.895 6.85 0.0 0.00 3.41 F
1170 1184 2.684881 CAAGTGGCTTTATTGGAGCGAT 59.315 45.455 0.00 0.0 41.03 4.58 F
1184 1198 3.643320 TGGAGCGATACATCCTTCTGAAT 59.357 43.478 0.00 0.0 36.50 2.57 F
3033 3064 3.739300 CGGTCTCTTTTGCGTTCTTCTTA 59.261 43.478 0.00 0.0 0.00 2.10 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2945 2976 2.438021 CCTATTAGGTGGGCTGCAACTA 59.562 50.000 0.50 0.0 0.00 2.24 R
3033 3064 7.466746 ACCACAGAAAATATGCAAGTAACAT 57.533 32.000 0.00 0.0 0.00 2.71 R
3200 3231 8.884323 TGAATCAACATATCCTCCTAAAGCTAT 58.116 33.333 0.00 0.0 0.00 2.97 R
3899 3953 6.465948 TCAAAGACCGGTAAGTATTTAAGCA 58.534 36.000 7.34 0.0 30.38 3.91 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
345 346 6.303259 GCAAATCGTGATTGTTAGTTGAAGTC 59.697 38.462 0.00 0.0 0.00 3.01
795 809 1.804748 ACTCTTGATTTTCGGCGGAAC 59.195 47.619 7.21 0.0 0.00 3.62
878 892 7.707467 AATTCCCTACCTACAAGAATGGTAT 57.293 36.000 0.00 0.0 35.99 2.73
976 990 1.446792 CTGCTTGATCGGCGTCAGT 60.447 57.895 6.85 0.0 0.00 3.41
1170 1184 2.684881 CAAGTGGCTTTATTGGAGCGAT 59.315 45.455 0.00 0.0 41.03 4.58
1184 1198 3.643320 TGGAGCGATACATCCTTCTGAAT 59.357 43.478 0.00 0.0 36.50 2.57
1656 1672 6.533730 TCCATTCTGTGTTCTCTGTTTACAT 58.466 36.000 0.00 0.0 0.00 2.29
1956 1972 7.978975 GGTTAAGAAAATAACATGCTGGCAATA 59.021 33.333 0.00 0.0 37.48 1.90
2617 2648 7.615039 TCGGTTGGGATATAGTTGGTATTAA 57.385 36.000 0.00 0.0 0.00 1.40
3033 3064 3.739300 CGGTCTCTTTTGCGTTCTTCTTA 59.261 43.478 0.00 0.0 0.00 2.10
3200 3231 2.355197 CAATTACATCAGACGTGCCCA 58.645 47.619 0.00 0.0 0.00 5.36
3632 3665 3.496131 CGGTGAACAATCGGCCCG 61.496 66.667 0.00 0.0 0.00 6.13
3899 3953 4.946157 CCCAAGAGTAGTCAGCAAAATCAT 59.054 41.667 0.00 0.0 0.00 2.45
4028 4082 0.539438 TGCTCCCTTGTTTCGCCAAT 60.539 50.000 0.00 0.0 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
795 809 1.942657 CAGTTGTTCTGACCCTGTGTG 59.057 52.381 0.00 0.0 46.27 3.82
878 892 6.608405 AGCAAATTTGATGACTATCCCATTCA 59.392 34.615 22.31 0.0 32.09 2.57
976 990 1.372997 GCTCGCGGACTGAAAGACA 60.373 57.895 6.13 0.0 37.43 3.41
1184 1198 9.256228 AGTGACTCCAATACACTCTTTAGATTA 57.744 33.333 0.00 0.0 40.19 1.75
2945 2976 2.438021 CCTATTAGGTGGGCTGCAACTA 59.562 50.000 0.50 0.0 0.00 2.24
3033 3064 7.466746 ACCACAGAAAATATGCAAGTAACAT 57.533 32.000 0.00 0.0 0.00 2.71
3200 3231 8.884323 TGAATCAACATATCCTCCTAAAGCTAT 58.116 33.333 0.00 0.0 0.00 2.97
3899 3953 6.465948 TCAAAGACCGGTAAGTATTTAAGCA 58.534 36.000 7.34 0.0 30.38 3.91


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.