Multiple sequence alignment - TraesCS5A01G208000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G208000 chr5A 100.000 2342 0 0 1 2342 420185603 420187944 0.000000e+00 4325.0
1 TraesCS5A01G208000 chr5A 98.811 2354 16 1 1 2342 16544455 16546808 0.000000e+00 4181.0
2 TraesCS5A01G208000 chr5A 90.204 245 18 1 2044 2282 327918944 327918700 4.860000e-82 315.0
3 TraesCS5A01G208000 chr5A 100.000 38 0 0 2014 2051 505903239 505903202 1.160000e-08 71.3
4 TraesCS5A01G208000 chr7B 98.726 2354 18 1 1 2342 716784508 716786861 0.000000e+00 4170.0
5 TraesCS5A01G208000 chr7B 98.641 2354 20 1 1 2342 742948837 742946484 0.000000e+00 4159.0
6 TraesCS5A01G208000 chr7B 95.690 2320 71 5 38 2342 139608300 139610605 0.000000e+00 3703.0
7 TraesCS5A01G208000 chr7A 98.726 2354 18 1 1 2342 60084837 60087190 0.000000e+00 4170.0
8 TraesCS5A01G208000 chr7A 98.726 2354 18 1 1 2342 60168866 60166513 0.000000e+00 4170.0
9 TraesCS5A01G208000 chr7A 97.601 1209 16 2 1146 2342 708248552 708249759 0.000000e+00 2060.0
10 TraesCS5A01G208000 chr1D 97.368 2356 42 4 1 2342 275778829 275781178 0.000000e+00 3989.0
11 TraesCS5A01G208000 chr6B 96.644 2354 53 5 1 2342 388287136 388284797 0.000000e+00 3886.0
12 TraesCS5A01G208000 chr2D 96.169 2349 68 7 1 2342 291773520 291775853 0.000000e+00 3819.0
13 TraesCS5A01G208000 chr2D 97.067 1057 17 2 1300 2342 17994366 17993310 0.000000e+00 1768.0
14 TraesCS5A01G208000 chrUn 97.824 1057 9 2 1300 2342 396261128 396262184 0.000000e+00 1812.0
15 TraesCS5A01G208000 chr7D 97.824 1057 9 2 1300 2342 579000820 578999764 0.000000e+00 1812.0
16 TraesCS5A01G208000 chr4D 96.978 1059 15 4 1300 2342 123699036 123697979 0.000000e+00 1762.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G208000 chr5A 420185603 420187944 2341 False 4325 4325 100.000 1 2342 1 chr5A.!!$F2 2341
1 TraesCS5A01G208000 chr5A 16544455 16546808 2353 False 4181 4181 98.811 1 2342 1 chr5A.!!$F1 2341
2 TraesCS5A01G208000 chr7B 716784508 716786861 2353 False 4170 4170 98.726 1 2342 1 chr7B.!!$F2 2341
3 TraesCS5A01G208000 chr7B 742946484 742948837 2353 True 4159 4159 98.641 1 2342 1 chr7B.!!$R1 2341
4 TraesCS5A01G208000 chr7B 139608300 139610605 2305 False 3703 3703 95.690 38 2342 1 chr7B.!!$F1 2304
5 TraesCS5A01G208000 chr7A 60084837 60087190 2353 False 4170 4170 98.726 1 2342 1 chr7A.!!$F1 2341
6 TraesCS5A01G208000 chr7A 60166513 60168866 2353 True 4170 4170 98.726 1 2342 1 chr7A.!!$R1 2341
7 TraesCS5A01G208000 chr7A 708248552 708249759 1207 False 2060 2060 97.601 1146 2342 1 chr7A.!!$F2 1196
8 TraesCS5A01G208000 chr1D 275778829 275781178 2349 False 3989 3989 97.368 1 2342 1 chr1D.!!$F1 2341
9 TraesCS5A01G208000 chr6B 388284797 388287136 2339 True 3886 3886 96.644 1 2342 1 chr6B.!!$R1 2341
10 TraesCS5A01G208000 chr2D 291773520 291775853 2333 False 3819 3819 96.169 1 2342 1 chr2D.!!$F1 2341
11 TraesCS5A01G208000 chr2D 17993310 17994366 1056 True 1768 1768 97.067 1300 2342 1 chr2D.!!$R1 1042
12 TraesCS5A01G208000 chrUn 396261128 396262184 1056 False 1812 1812 97.824 1300 2342 1 chrUn.!!$F1 1042
13 TraesCS5A01G208000 chr7D 578999764 579000820 1056 True 1812 1812 97.824 1300 2342 1 chr7D.!!$R1 1042
14 TraesCS5A01G208000 chr4D 123697979 123699036 1057 True 1762 1762 96.978 1300 2342 1 chr4D.!!$R1 1042

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
669 670 1.073284 GGTTGCCCCTTACTCACAGAA 59.927 52.381 0.0 0.0 0.0 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1534 1538 1.044611 GCCTTCCAGAGCCTACCTAG 58.955 60.0 0.0 0.0 0.0 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
669 670 1.073284 GGTTGCCCCTTACTCACAGAA 59.927 52.381 0.00 0.0 0.00 3.02
877 878 5.956426 ACCCCCTACCTATACCTATACCTA 58.044 45.833 0.00 0.0 0.00 3.08
993 994 4.098807 GTGGTCCGCATAACCCAATATTTT 59.901 41.667 0.00 0.0 35.84 1.82
1315 1317 4.080186 TGATGGCCTTTCTGATCTCATTCA 60.080 41.667 3.32 0.0 0.00 2.57
1534 1538 0.806102 ATCCGCGTGTATGTCTGTGC 60.806 55.000 4.92 0.0 0.00 4.57
1538 1542 1.560923 GCGTGTATGTCTGTGCTAGG 58.439 55.000 0.00 0.0 0.00 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
664 665 4.984146 AAAGCCTTCTTCCTACTTCTGT 57.016 40.909 0.00 0.0 0.0 3.41
669 670 3.617775 GCGAGAAAAGCCTTCTTCCTACT 60.618 47.826 0.51 0.0 0.0 2.57
993 994 3.295973 GGCCTGCACCTCCATAATTTTA 58.704 45.455 0.00 0.0 0.0 1.52
1315 1317 6.189677 TGACTTTTTATGCGATCGGAAAAT 57.810 33.333 14.89 0.0 0.0 1.82
1534 1538 1.044611 GCCTTCCAGAGCCTACCTAG 58.955 60.000 0.00 0.0 0.0 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.