Multiple sequence alignment - TraesCS5A01G207900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G207900 chr5A 100.000 2681 0 0 1 2681 420184559 420187239 0.000000e+00 4951
1 TraesCS5A01G207900 chr5A 99.068 2682 24 1 1 2681 16543410 16546091 0.000000e+00 4813
2 TraesCS5A01G207900 chr7A 99.217 2682 19 2 1 2681 60083793 60086473 0.000000e+00 4835
3 TraesCS5A01G207900 chr7A 99.068 2682 24 1 1 2681 60169911 60167230 0.000000e+00 4813
4 TraesCS5A01G207900 chr7B 99.180 2682 21 1 1 2681 742949882 742947201 0.000000e+00 4830
5 TraesCS5A01G207900 chr7B 98.919 2682 28 1 1 2681 716783463 716786144 0.000000e+00 4791
6 TraesCS5A01G207900 chr2A 98.626 2621 35 1 1 2620 755479405 755482025 0.000000e+00 4639
7 TraesCS5A01G207900 chr6B 97.614 2682 61 3 1 2681 388288180 388285501 0.000000e+00 4595
8 TraesCS5A01G207900 chr2D 96.606 2681 76 5 2 2681 291772476 291775142 0.000000e+00 4433
9 TraesCS5A01G207900 chr4D 98.409 2452 37 2 1 2450 123348977 123351428 0.000000e+00 4311
10 TraesCS5A01G207900 chr3B 98.521 338 5 0 2344 2681 759913745 759914082 4.940000e-167 597


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G207900 chr5A 420184559 420187239 2680 False 4951 4951 100.000 1 2681 1 chr5A.!!$F2 2680
1 TraesCS5A01G207900 chr5A 16543410 16546091 2681 False 4813 4813 99.068 1 2681 1 chr5A.!!$F1 2680
2 TraesCS5A01G207900 chr7A 60083793 60086473 2680 False 4835 4835 99.217 1 2681 1 chr7A.!!$F1 2680
3 TraesCS5A01G207900 chr7A 60167230 60169911 2681 True 4813 4813 99.068 1 2681 1 chr7A.!!$R1 2680
4 TraesCS5A01G207900 chr7B 742947201 742949882 2681 True 4830 4830 99.180 1 2681 1 chr7B.!!$R1 2680
5 TraesCS5A01G207900 chr7B 716783463 716786144 2681 False 4791 4791 98.919 1 2681 1 chr7B.!!$F1 2680
6 TraesCS5A01G207900 chr2A 755479405 755482025 2620 False 4639 4639 98.626 1 2620 1 chr2A.!!$F1 2619
7 TraesCS5A01G207900 chr6B 388285501 388288180 2679 True 4595 4595 97.614 1 2681 1 chr6B.!!$R1 2680
8 TraesCS5A01G207900 chr2D 291772476 291775142 2666 False 4433 4433 96.606 2 2681 1 chr2D.!!$F1 2679
9 TraesCS5A01G207900 chr4D 123348977 123351428 2451 False 4311 4311 98.409 1 2450 1 chr4D.!!$F1 2449

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
795 797 1.370609 TTGGACAAAAACGCTCGACA 58.629 45.0 0.0 0.0 0.0 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2578 2581 1.044611 GCCTTCCAGAGCCTACCTAG 58.955 60.0 0.0 0.0 0.0 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 8.602424 TCCCATCTCTTCTTGTTATTGTCTTTA 58.398 33.333 0.00 0.0 0.00 1.85
676 678 6.381994 ACTTATAATCGGGGACAGACAAACTA 59.618 38.462 0.00 0.0 0.00 2.24
795 797 1.370609 TTGGACAAAAACGCTCGACA 58.629 45.000 0.00 0.0 0.00 4.35
1713 1715 1.073284 GGTTGCCCCTTACTCACAGAA 59.927 52.381 0.00 0.0 0.00 3.02
1921 1923 5.956426 ACCCCCTACCTATACCTATACCTA 58.044 45.833 0.00 0.0 0.00 3.08
2037 2039 4.098807 GTGGTCCGCATAACCCAATATTTT 59.901 41.667 0.00 0.0 35.84 1.82
2359 2362 4.080186 TGATGGCCTTTCTGATCTCATTCA 60.080 41.667 3.32 0.0 0.00 2.57
2578 2581 0.806102 ATCCGCGTGTATGTCTGTGC 60.806 55.000 4.92 0.0 0.00 4.57
2582 2585 1.560923 GCGTGTATGTCTGTGCTAGG 58.439 55.000 0.00 0.0 0.00 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
484 485 2.840511 TCAATAGGTACTCCCAAGGCA 58.159 47.619 0.00 0.00 41.75 4.75
676 678 7.928706 AGTATCGATAGCTATTGCAGTTTTTCT 59.071 33.333 15.27 3.73 42.74 2.52
795 797 6.655078 AGAATTTGAACTAATTGTGCCACT 57.345 33.333 0.00 0.00 0.00 4.00
1708 1710 4.984146 AAAGCCTTCTTCCTACTTCTGT 57.016 40.909 0.00 0.00 0.00 3.41
1713 1715 3.617775 GCGAGAAAAGCCTTCTTCCTACT 60.618 47.826 0.51 0.00 0.00 2.57
2037 2039 3.295973 GGCCTGCACCTCCATAATTTTA 58.704 45.455 0.00 0.00 0.00 1.52
2359 2362 6.189677 TGACTTTTTATGCGATCGGAAAAT 57.810 33.333 14.89 0.00 0.00 1.82
2578 2581 1.044611 GCCTTCCAGAGCCTACCTAG 58.955 60.000 0.00 0.00 0.00 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.