Multiple sequence alignment - TraesCS5A01G196300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G196300 chr5A 100.000 2607 0 0 1 2607 400076583 400073977 0 4815
1 TraesCS5A01G196300 chr5A 98.393 2613 33 7 1 2607 687724738 687722129 0 4584
2 TraesCS5A01G196300 chr3B 98.736 2610 26 6 1 2607 193971338 193968733 0 4630
3 TraesCS5A01G196300 chr3B 98.469 2612 31 9 1 2607 11248187 11250794 0 4593
4 TraesCS5A01G196300 chr3A 98.621 2610 30 6 1 2607 591384380 591381774 0 4615
5 TraesCS5A01G196300 chr1A 98.582 2609 32 5 1 2607 521311188 521313793 0 4608
6 TraesCS5A01G196300 chr1B 98.545 2611 33 5 1 2607 419959908 419962517 0 4606
7 TraesCS5A01G196300 chr7A 98.507 2612 31 7 1 2607 393650428 393647820 0 4601
8 TraesCS5A01G196300 chr7A 98.467 2609 34 6 1 2607 457559982 457562586 0 4591
9 TraesCS5A01G196300 chr7B 98.391 2611 37 5 1 2607 570475189 570472580 0 4584


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G196300 chr5A 400073977 400076583 2606 True 4815 4815 100.000 1 2607 1 chr5A.!!$R1 2606
1 TraesCS5A01G196300 chr5A 687722129 687724738 2609 True 4584 4584 98.393 1 2607 1 chr5A.!!$R2 2606
2 TraesCS5A01G196300 chr3B 193968733 193971338 2605 True 4630 4630 98.736 1 2607 1 chr3B.!!$R1 2606
3 TraesCS5A01G196300 chr3B 11248187 11250794 2607 False 4593 4593 98.469 1 2607 1 chr3B.!!$F1 2606
4 TraesCS5A01G196300 chr3A 591381774 591384380 2606 True 4615 4615 98.621 1 2607 1 chr3A.!!$R1 2606
5 TraesCS5A01G196300 chr1A 521311188 521313793 2605 False 4608 4608 98.582 1 2607 1 chr1A.!!$F1 2606
6 TraesCS5A01G196300 chr1B 419959908 419962517 2609 False 4606 4606 98.545 1 2607 1 chr1B.!!$F1 2606
7 TraesCS5A01G196300 chr7A 393647820 393650428 2608 True 4601 4601 98.507 1 2607 1 chr7A.!!$R1 2606
8 TraesCS5A01G196300 chr7A 457559982 457562586 2604 False 4591 4591 98.467 1 2607 1 chr7A.!!$F1 2606
9 TraesCS5A01G196300 chr7B 570472580 570475189 2609 True 4584 4584 98.391 1 2607 1 chr7B.!!$R1 2606

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
595 600 2.455557 TGTGACCTGCAAAATATGGGG 58.544 47.619 0.0 0.0 0.00 4.96 F
1088 1097 2.035961 TCTGTCTTGACCTGAAGAACCG 59.964 50.000 0.0 0.0 33.73 4.44 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1462 1472 0.829990 TTGCATCTGTGATAGCGGGA 59.170 50.0 0.0 0.0 0.0 5.14 R
1918 1935 5.182001 GTCTGTTGAACTACATTTGCCATCT 59.818 40.0 0.0 0.0 0.0 2.90 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
199 200 3.899835 CGATATCGTCAAGCGTTTTGA 57.100 42.857 17.06 1.13 42.13 2.69
412 417 4.650734 TCATACAGCTCATGTTTGGACAA 58.349 39.130 5.05 0.00 39.96 3.18
574 579 6.513230 GCCGACAAGATAATCATGCATTACAA 60.513 38.462 0.00 0.00 29.24 2.41
595 600 2.455557 TGTGACCTGCAAAATATGGGG 58.544 47.619 0.00 0.00 0.00 4.96
1088 1097 2.035961 TCTGTCTTGACCTGAAGAACCG 59.964 50.000 0.00 0.00 33.73 4.44
1194 1203 3.432378 AGAGACTTGGAACCGTCACTAT 58.568 45.455 0.00 0.00 30.28 2.12
1215 1224 7.121759 CACTATGAACATTCAAAGGTCCAGATT 59.878 37.037 0.00 0.00 41.13 2.40
1387 1397 3.552684 CCATTTTGCGTGTTCACCTGAAT 60.553 43.478 0.00 0.00 36.33 2.57
1462 1472 2.683211 AGTGGGAAGGCAGAATTGTT 57.317 45.000 0.00 0.00 0.00 2.83
1770 1781 3.250280 TGGCGTGTTAGCGACATTTTTAA 59.750 39.130 0.00 0.00 45.85 1.52
2434 2456 7.415095 GCAGATTAACTACACATAACATGGCAA 60.415 37.037 0.00 0.00 33.60 4.52
2527 2551 6.886459 CCTCAAGAGTCATTCTCCCAATTAAA 59.114 38.462 0.00 0.00 43.71 1.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
199 200 0.598065 GCTGTTGGTCCTCGCATTTT 59.402 50.000 0.00 0.0 0.00 1.82
352 355 6.817184 TGGAAGAATCATGCCTACTAAGTAC 58.183 40.000 0.00 0.0 0.00 2.73
412 417 2.032030 CCGCACTGAATGACTTTCGTTT 60.032 45.455 0.00 0.0 37.13 3.60
574 579 3.033184 CCCCATATTTTGCAGGTCACAT 58.967 45.455 0.00 0.0 0.00 3.21
992 1001 1.307647 ATGGGGAACATGACCTGCC 59.692 57.895 0.00 0.0 38.70 4.85
1088 1097 2.493713 ATCAAGCACCTCGATACGTC 57.506 50.000 0.00 0.0 0.00 4.34
1194 1203 5.945784 CCTAATCTGGACCTTTGAATGTTCA 59.054 40.000 0.00 0.0 34.92 3.18
1215 1224 1.568504 ACTCAGTCGGGAAATGCCTA 58.431 50.000 0.00 0.0 36.66 3.93
1429 1439 4.524328 CCTTCCCACTTTGCAAAGTATTCT 59.476 41.667 37.19 17.5 46.89 2.40
1462 1472 0.829990 TTGCATCTGTGATAGCGGGA 59.170 50.000 0.00 0.0 0.00 5.14
1770 1781 7.360861 CGTCCACACATGTATTACAGAAAACAT 60.361 37.037 0.00 0.0 32.91 2.71
1918 1935 5.182001 GTCTGTTGAACTACATTTGCCATCT 59.818 40.000 0.00 0.0 0.00 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.