Multiple sequence alignment - TraesCS5A01G192900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G192900 chr5A 100.000 2327 0 0 1 2327 396386631 396388957 0.000000e+00 4298.0
1 TraesCS5A01G192900 chr5A 96.319 815 21 7 1 813 219229459 219230266 0.000000e+00 1330.0
2 TraesCS5A01G192900 chr5A 91.340 612 46 2 94 702 564414923 564415530 0.000000e+00 830.0
3 TraesCS5A01G192900 chr5A 100.000 33 0 0 49 81 384865117 384865085 6.940000e-06 62.1
4 TraesCS5A01G192900 chr3A 96.850 1619 46 4 709 2327 736941207 736939594 0.000000e+00 2702.0
5 TraesCS5A01G192900 chr3A 95.397 1586 46 10 725 2305 539847873 539849436 0.000000e+00 2499.0
6 TraesCS5A01G192900 chr3A 95.703 768 18 2 1 768 736312946 736313698 0.000000e+00 1221.0
7 TraesCS5A01G192900 chr3A 89.011 91 7 1 734 824 184680175 184680088 2.440000e-20 110.0
8 TraesCS5A01G192900 chr4A 93.135 1617 80 8 727 2327 140718684 140717083 0.000000e+00 2342.0
9 TraesCS5A01G192900 chr4A 90.638 705 48 7 895 1586 29295734 29296433 0.000000e+00 920.0
10 TraesCS5A01G192900 chr4A 91.830 612 43 2 94 702 689250799 689250192 0.000000e+00 846.0
11 TraesCS5A01G192900 chr1A 93.491 1567 86 6 775 2327 384105722 384107286 0.000000e+00 2314.0
12 TraesCS5A01G192900 chr1A 93.295 1581 72 9 764 2327 102379066 102377503 0.000000e+00 2302.0
13 TraesCS5A01G192900 chr7A 92.257 1356 59 17 995 2327 33752553 33751221 0.000000e+00 1881.0
14 TraesCS5A01G192900 chr7A 92.288 765 44 7 1 764 483282413 483283163 0.000000e+00 1072.0
15 TraesCS5A01G192900 chr7A 92.571 673 41 1 725 1397 33753239 33752576 0.000000e+00 957.0
16 TraesCS5A01G192900 chr7A 95.567 203 9 0 775 977 299501379 299501581 2.230000e-85 326.0
17 TraesCS5A01G192900 chr7D 94.393 749 30 4 1580 2327 623598038 623597301 0.000000e+00 1140.0
18 TraesCS5A01G192900 chr4B 90.374 696 51 7 903 1586 545148728 545149419 0.000000e+00 900.0
19 TraesCS5A01G192900 chr5D 93.613 595 37 1 1580 2174 31089590 31090183 0.000000e+00 887.0
20 TraesCS5A01G192900 chr7B 91.654 635 52 1 1580 2213 178766768 178767402 0.000000e+00 878.0
21 TraesCS5A01G192900 chr4D 92.270 608 36 4 986 1586 440038157 440038760 0.000000e+00 852.0
22 TraesCS5A01G192900 chr2B 91.340 612 46 2 94 702 86662855 86663462 0.000000e+00 830.0
23 TraesCS5A01G192900 chr3B 91.176 612 46 3 94 702 799752799 799752193 0.000000e+00 824.0
24 TraesCS5A01G192900 chr3B 94.872 39 2 0 43 81 730762019 730762057 6.940000e-06 62.1
25 TraesCS5A01G192900 chr2D 89.251 614 55 7 94 699 231606370 231606980 0.000000e+00 758.0
26 TraesCS5A01G192900 chr5B 89.238 604 59 3 101 699 446561614 446561012 0.000000e+00 750.0
27 TraesCS5A01G192900 chr6D 94.142 478 21 1 1396 1866 291620574 291621051 0.000000e+00 721.0
28 TraesCS5A01G192900 chr6D 88.336 583 35 16 778 1352 291620022 291620579 0.000000e+00 669.0
29 TraesCS5A01G192900 chrUn 93.595 484 23 2 1390 1866 114827759 114828241 0.000000e+00 715.0
30 TraesCS5A01G192900 chrUn 93.636 110 6 1 1 110 309167482 309167374 1.850000e-36 163.0
31 TraesCS5A01G192900 chrUn 93.636 110 6 1 1 110 344253009 344253117 1.850000e-36 163.0
32 TraesCS5A01G192900 chrUn 93.636 110 6 1 1 110 437208913 437209021 1.850000e-36 163.0
33 TraesCS5A01G192900 chr6B 96.970 33 1 0 49 81 637364056 637364024 3.230000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G192900 chr5A 396386631 396388957 2326 False 4298 4298 100.000 1 2327 1 chr5A.!!$F2 2326
1 TraesCS5A01G192900 chr5A 219229459 219230266 807 False 1330 1330 96.319 1 813 1 chr5A.!!$F1 812
2 TraesCS5A01G192900 chr5A 564414923 564415530 607 False 830 830 91.340 94 702 1 chr5A.!!$F3 608
3 TraesCS5A01G192900 chr3A 736939594 736941207 1613 True 2702 2702 96.850 709 2327 1 chr3A.!!$R2 1618
4 TraesCS5A01G192900 chr3A 539847873 539849436 1563 False 2499 2499 95.397 725 2305 1 chr3A.!!$F1 1580
5 TraesCS5A01G192900 chr3A 736312946 736313698 752 False 1221 1221 95.703 1 768 1 chr3A.!!$F2 767
6 TraesCS5A01G192900 chr4A 140717083 140718684 1601 True 2342 2342 93.135 727 2327 1 chr4A.!!$R1 1600
7 TraesCS5A01G192900 chr4A 29295734 29296433 699 False 920 920 90.638 895 1586 1 chr4A.!!$F1 691
8 TraesCS5A01G192900 chr4A 689250192 689250799 607 True 846 846 91.830 94 702 1 chr4A.!!$R2 608
9 TraesCS5A01G192900 chr1A 384105722 384107286 1564 False 2314 2314 93.491 775 2327 1 chr1A.!!$F1 1552
10 TraesCS5A01G192900 chr1A 102377503 102379066 1563 True 2302 2302 93.295 764 2327 1 chr1A.!!$R1 1563
11 TraesCS5A01G192900 chr7A 33751221 33753239 2018 True 1419 1881 92.414 725 2327 2 chr7A.!!$R1 1602
12 TraesCS5A01G192900 chr7A 483282413 483283163 750 False 1072 1072 92.288 1 764 1 chr7A.!!$F2 763
13 TraesCS5A01G192900 chr7D 623597301 623598038 737 True 1140 1140 94.393 1580 2327 1 chr7D.!!$R1 747
14 TraesCS5A01G192900 chr4B 545148728 545149419 691 False 900 900 90.374 903 1586 1 chr4B.!!$F1 683
15 TraesCS5A01G192900 chr5D 31089590 31090183 593 False 887 887 93.613 1580 2174 1 chr5D.!!$F1 594
16 TraesCS5A01G192900 chr7B 178766768 178767402 634 False 878 878 91.654 1580 2213 1 chr7B.!!$F1 633
17 TraesCS5A01G192900 chr4D 440038157 440038760 603 False 852 852 92.270 986 1586 1 chr4D.!!$F1 600
18 TraesCS5A01G192900 chr2B 86662855 86663462 607 False 830 830 91.340 94 702 1 chr2B.!!$F1 608
19 TraesCS5A01G192900 chr3B 799752193 799752799 606 True 824 824 91.176 94 702 1 chr3B.!!$R1 608
20 TraesCS5A01G192900 chr2D 231606370 231606980 610 False 758 758 89.251 94 699 1 chr2D.!!$F1 605
21 TraesCS5A01G192900 chr5B 446561012 446561614 602 True 750 750 89.238 101 699 1 chr5B.!!$R1 598
22 TraesCS5A01G192900 chr6D 291620022 291621051 1029 False 695 721 91.239 778 1866 2 chr6D.!!$F1 1088

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
597 609 1.216064 TATCTGGTTGCTGCATCCCT 58.784 50.0 23.19 12.56 0.0 4.2 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1572 2041 1.531602 GGCCAGCAAGAACTTGGGT 60.532 57.895 14.95 1.09 40.74 4.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
44 45 7.676004 TGAGCGTAGATCCATTCCAAAATATA 58.324 34.615 0.00 0.00 45.64 0.86
154 159 8.712285 TTAGCAGTACATAACCAACTAACATC 57.288 34.615 0.00 0.00 0.00 3.06
597 609 1.216064 TATCTGGTTGCTGCATCCCT 58.784 50.000 23.19 12.56 0.00 4.20
856 877 8.316046 AGTCATAATACGTTTTTACGATTCGTG 58.684 33.333 21.40 6.22 41.39 4.35
1093 1120 2.436109 GGCTGCACAGGAAAGGGA 59.564 61.111 0.50 0.00 0.00 4.20
1120 1147 2.203640 TGGTGCTGGAGTCGTCCT 60.204 61.111 0.00 0.00 44.30 3.85
1257 1295 1.372872 CGTCATGTCAGCGTCCACA 60.373 57.895 0.00 0.00 0.00 4.17
2279 2752 6.974622 GCACATATATATATGCCAACAAAGCC 59.025 38.462 26.04 5.34 42.98 4.35
2288 2761 3.364549 TGCCAACAAAGCCAGCTTATAT 58.635 40.909 5.12 0.00 34.84 0.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
51 52 1.448985 GTGCGTTGCAAAGGGAGATA 58.551 50.000 14.31 0.00 41.47 1.98
552 564 7.698163 ATAAATCATATACTCCCTCCATCCC 57.302 40.000 0.00 0.00 0.00 3.85
623 635 8.642935 TTTCCAACCAACATAAATCAGTATCA 57.357 30.769 0.00 0.00 0.00 2.15
624 636 8.956426 TCTTTCCAACCAACATAAATCAGTATC 58.044 33.333 0.00 0.00 0.00 2.24
931 958 0.109039 GACTTTCGGAAGAGAGCGCT 60.109 55.000 11.27 11.27 45.50 5.92
1023 1050 0.455815 CCACGATCACGATGTCCTCA 59.544 55.000 0.00 0.00 42.66 3.86
1257 1295 3.772025 CCACTTCCTTCACTATCTCACCT 59.228 47.826 0.00 0.00 0.00 4.00
1572 2041 1.531602 GGCCAGCAAGAACTTGGGT 60.532 57.895 14.95 1.09 40.74 4.51
1720 2189 3.723097 TTCCCAAACAGCCCACGCA 62.723 57.895 0.00 0.00 37.52 5.24
2266 2739 1.631405 TAAGCTGGCTTTGTTGGCAT 58.369 45.000 13.14 0.00 41.63 4.40
2267 2740 1.631405 ATAAGCTGGCTTTGTTGGCA 58.369 45.000 13.14 0.00 40.25 4.92


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.