Multiple sequence alignment - TraesCS5A01G164100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G164100 chr5A 100.000 3153 0 0 1 3153 352407600 352404448 0.000000e+00 5823.0
1 TraesCS5A01G164100 chr5A 97.368 3191 29 9 2 3153 559464166 559460992 0.000000e+00 5376.0
2 TraesCS5A01G164100 chr6B 96.956 3187 57 10 6 3153 184671485 184668300 0.000000e+00 5312.0
3 TraesCS5A01G164100 chr7B 95.962 2105 37 14 1067 3153 3900431 3898357 0.000000e+00 3373.0
4 TraesCS5A01G164100 chr7B 86.486 148 20 0 980 1127 3900548 3900401 2.520000e-36 163.0
5 TraesCS5A01G164100 chr7B 84.302 172 19 4 3 170 598172709 598172542 9.050000e-36 161.0
6 TraesCS5A01G164100 chr7B 84.615 156 19 5 17 170 12744208 12744056 1.960000e-32 150.0
7 TraesCS5A01G164100 chr2A 95.145 2101 58 16 1069 3153 596259812 596257740 0.000000e+00 3275.0
8 TraesCS5A01G164100 chr2A 82.222 360 41 12 6 345 596260878 596260522 3.980000e-74 289.0
9 TraesCS5A01G164100 chr2A 81.818 88 12 4 457 543 657163570 657163486 1.570000e-08 71.3
10 TraesCS5A01G164100 chr2B 96.784 1679 27 4 364 2016 464442936 464444613 0.000000e+00 2776.0
11 TraesCS5A01G164100 chr2B 98.193 996 18 0 2158 3153 464453541 464454536 0.000000e+00 1740.0
12 TraesCS5A01G164100 chr2B 87.885 1007 68 16 419 1391 23733869 23732883 0.000000e+00 1134.0
13 TraesCS5A01G164100 chr2B 94.673 413 9 4 4 403 464442523 464442935 2.060000e-176 628.0
14 TraesCS5A01G164100 chr2B 85.231 325 30 8 6 313 23734451 23734128 5.070000e-83 318.0
15 TraesCS5A01G164100 chr4B 98.253 1374 22 2 1781 3153 530203023 530201651 0.000000e+00 2403.0
16 TraesCS5A01G164100 chr4B 95.514 1293 49 6 1069 2356 467802773 467804061 0.000000e+00 2058.0
17 TraesCS5A01G164100 chr4B 97.295 998 23 4 2158 3153 467804059 467805054 0.000000e+00 1690.0
18 TraesCS5A01G164100 chr4B 81.543 363 45 11 3 345 467801701 467802061 2.390000e-71 279.0
19 TraesCS5A01G164100 chr3B 94.096 1389 58 10 1067 2437 252334151 252335533 0.000000e+00 2089.0
20 TraesCS5A01G164100 chr5B 94.996 1299 56 6 1069 2361 655129359 655130654 0.000000e+00 2030.0
21 TraesCS5A01G164100 chr5B 97.091 997 27 2 2158 3153 655130495 655131490 0.000000e+00 1679.0
22 TraesCS5A01G164100 chr7A 89.211 1622 134 16 1557 3153 164104956 164103351 0.000000e+00 1988.0
23 TraesCS5A01G164100 chr7A 92.004 988 59 10 227 1194 148833794 148834781 0.000000e+00 1369.0
24 TraesCS5A01G164100 chr7A 88.641 449 45 6 1069 1514 164105387 164104942 2.770000e-150 542.0
25 TraesCS5A01G164100 chr3D 95.282 1081 44 5 2079 3153 92510109 92511188 0.000000e+00 1707.0
26 TraesCS5A01G164100 chr4D 84.127 630 66 17 541 1148 77317557 77318174 2.110000e-161 579.0
27 TraesCS5A01G164100 chr7D 86.982 169 19 3 3 170 70179397 70179231 1.490000e-43 187.0
28 TraesCS5A01G164100 chr7D 83.766 154 25 0 980 1133 70045259 70045412 2.530000e-31 147.0
29 TraesCS5A01G164100 chr7D 84.459 148 23 0 986 1133 70157052 70156905 2.530000e-31 147.0
30 TraesCS5A01G164100 chr1B 84.000 125 9 9 161 279 603219204 603219323 3.320000e-20 110.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G164100 chr5A 352404448 352407600 3152 True 5823.000000 5823 100.000000 1 3153 1 chr5A.!!$R1 3152
1 TraesCS5A01G164100 chr5A 559460992 559464166 3174 True 5376.000000 5376 97.368000 2 3153 1 chr5A.!!$R2 3151
2 TraesCS5A01G164100 chr6B 184668300 184671485 3185 True 5312.000000 5312 96.956000 6 3153 1 chr6B.!!$R1 3147
3 TraesCS5A01G164100 chr7B 3898357 3900548 2191 True 1768.000000 3373 91.224000 980 3153 2 chr7B.!!$R3 2173
4 TraesCS5A01G164100 chr2A 596257740 596260878 3138 True 1782.000000 3275 88.683500 6 3153 2 chr2A.!!$R2 3147
5 TraesCS5A01G164100 chr2B 464453541 464454536 995 False 1740.000000 1740 98.193000 2158 3153 1 chr2B.!!$F1 995
6 TraesCS5A01G164100 chr2B 464442523 464444613 2090 False 1702.000000 2776 95.728500 4 2016 2 chr2B.!!$F2 2012
7 TraesCS5A01G164100 chr2B 23732883 23734451 1568 True 726.000000 1134 86.558000 6 1391 2 chr2B.!!$R1 1385
8 TraesCS5A01G164100 chr4B 530201651 530203023 1372 True 2403.000000 2403 98.253000 1781 3153 1 chr4B.!!$R1 1372
9 TraesCS5A01G164100 chr4B 467801701 467805054 3353 False 1342.333333 2058 91.450667 3 3153 3 chr4B.!!$F1 3150
10 TraesCS5A01G164100 chr3B 252334151 252335533 1382 False 2089.000000 2089 94.096000 1067 2437 1 chr3B.!!$F1 1370
11 TraesCS5A01G164100 chr5B 655129359 655131490 2131 False 1854.500000 2030 96.043500 1069 3153 2 chr5B.!!$F1 2084
12 TraesCS5A01G164100 chr7A 148833794 148834781 987 False 1369.000000 1369 92.004000 227 1194 1 chr7A.!!$F1 967
13 TraesCS5A01G164100 chr7A 164103351 164105387 2036 True 1265.000000 1988 88.926000 1069 3153 2 chr7A.!!$R1 2084
14 TraesCS5A01G164100 chr3D 92510109 92511188 1079 False 1707.000000 1707 95.282000 2079 3153 1 chr3D.!!$F1 1074
15 TraesCS5A01G164100 chr4D 77317557 77318174 617 False 579.000000 579 84.127000 541 1148 1 chr4D.!!$F1 607

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
647 830 1.202359 CCCGCTTCTGCTAGAGAGAAC 60.202 57.143 0.0 0.0 36.97 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2503 3334 3.61869 AGTTGATCTAGTTGAGCACCC 57.381 47.619 0.0 0.0 41.17 4.61 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
647 830 1.202359 CCCGCTTCTGCTAGAGAGAAC 60.202 57.143 0.0 0.0 36.97 3.01
648 831 1.474478 CCGCTTCTGCTAGAGAGAACA 59.526 52.381 0.0 0.0 36.97 3.18
650 833 2.421775 CGCTTCTGCTAGAGAGAACAGA 59.578 50.000 0.0 0.0 37.38 3.41
660 999 5.880332 GCTAGAGAGAACAGAGAGAAAGAGA 59.120 44.000 0.0 0.0 0.00 3.10
661 1000 6.037610 GCTAGAGAGAACAGAGAGAAAGAGAG 59.962 46.154 0.0 0.0 0.00 3.20
1418 1969 9.013229 AGAACAAGTGAATAGATTTTGTGCATA 57.987 29.630 0.0 0.0 31.17 3.14
1815 2368 1.826385 CGGGCTCAAAGTTCTTCCAT 58.174 50.000 0.0 0.0 0.00 3.41
2503 3334 2.509336 GTCCACGGATCTGCCACG 60.509 66.667 0.0 0.0 35.94 4.94
2535 3366 0.874390 GATCAACTTGCCGCTGACAA 59.126 50.000 0.0 0.0 0.00 3.18
3059 3893 6.262720 CCAAAGAAAGAATGCCAAATCCAAAA 59.737 34.615 0.0 0.0 0.00 2.44
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 0.615331 TGCTGGACTTGCTCTTAGGG 59.385 55.000 0.00 0.00 0.00 3.53
39 41 5.409826 GCTTTTCTCCCCTATAATGACGATG 59.590 44.000 0.00 0.00 0.00 3.84
80 86 1.664306 GAGACGTTCGGGGAACTGT 59.336 57.895 6.89 6.37 40.05 3.55
647 830 6.487668 TCATATCTCTGCTCTCTTTCTCTCTG 59.512 42.308 0.00 0.00 0.00 3.35
648 831 6.604171 TCATATCTCTGCTCTCTTTCTCTCT 58.396 40.000 0.00 0.00 0.00 3.10
650 833 6.604171 TCTCATATCTCTGCTCTCTTTCTCT 58.396 40.000 0.00 0.00 0.00 3.10
660 999 5.597594 TCACAACATCTCTCATATCTCTGCT 59.402 40.000 0.00 0.00 0.00 4.24
661 1000 5.840715 TCACAACATCTCTCATATCTCTGC 58.159 41.667 0.00 0.00 0.00 4.26
1815 2368 7.426606 TCCATGGCACTACTATTAACTGTAA 57.573 36.000 6.96 0.00 0.00 2.41
2503 3334 3.618690 AGTTGATCTAGTTGAGCACCC 57.381 47.619 0.00 0.00 41.17 4.61
2535 3366 7.604164 AGTGATATTCGAGACAAACAAGTTCAT 59.396 33.333 0.00 0.00 0.00 2.57
3059 3893 2.321213 GCCGTTGCTTCACAAGACT 58.679 52.632 0.00 0.00 39.50 3.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.