Multiple sequence alignment - TraesCS5A01G137900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G137900 chr5A 100.000 2426 0 0 1 2426 310189969 310192394 0 4481
1 TraesCS5A01G137900 chr5A 96.621 2427 74 3 1 2426 363676779 363674360 0 4021
2 TraesCS5A01G137900 chr5A 96.168 2427 85 6 1 2426 599831411 599833830 0 3960
3 TraesCS5A01G137900 chr4A 96.457 2427 79 4 1 2426 109206054 109203634 0 3999
4 TraesCS5A01G137900 chr4A 96.086 2427 88 7 1 2426 486158123 486155703 0 3949
5 TraesCS5A01G137900 chr1A 96.334 2428 80 8 1 2426 491362313 491359893 0 3982
6 TraesCS5A01G137900 chr1A 96.127 2427 83 8 1 2426 430649274 430646858 0 3951
7 TraesCS5A01G137900 chr3A 96.333 2427 78 4 1 2426 58987500 58985084 0 3978
8 TraesCS5A01G137900 chr2A 96.105 2439 81 4 1 2426 647915201 647912764 0 3965
9 TraesCS5A01G137900 chr6A 96.087 2428 91 3 2 2426 520264713 520267139 0 3954


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G137900 chr5A 310189969 310192394 2425 False 4481 4481 100.000 1 2426 1 chr5A.!!$F1 2425
1 TraesCS5A01G137900 chr5A 363674360 363676779 2419 True 4021 4021 96.621 1 2426 1 chr5A.!!$R1 2425
2 TraesCS5A01G137900 chr5A 599831411 599833830 2419 False 3960 3960 96.168 1 2426 1 chr5A.!!$F2 2425
3 TraesCS5A01G137900 chr4A 109203634 109206054 2420 True 3999 3999 96.457 1 2426 1 chr4A.!!$R1 2425
4 TraesCS5A01G137900 chr4A 486155703 486158123 2420 True 3949 3949 96.086 1 2426 1 chr4A.!!$R2 2425
5 TraesCS5A01G137900 chr1A 491359893 491362313 2420 True 3982 3982 96.334 1 2426 1 chr1A.!!$R2 2425
6 TraesCS5A01G137900 chr1A 430646858 430649274 2416 True 3951 3951 96.127 1 2426 1 chr1A.!!$R1 2425
7 TraesCS5A01G137900 chr3A 58985084 58987500 2416 True 3978 3978 96.333 1 2426 1 chr3A.!!$R1 2425
8 TraesCS5A01G137900 chr2A 647912764 647915201 2437 True 3965 3965 96.105 1 2426 1 chr2A.!!$R1 2425
9 TraesCS5A01G137900 chr6A 520264713 520267139 2426 False 3954 3954 96.087 2 2426 1 chr6A.!!$F1 2424

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
156 157 0.036448 TCAGGACGAAGAGACCTCGT 59.964 55.0 0.0 0.0 43.03 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1571 1574 0.623031 TGGTCTCCATGCATACCCCA 60.623 55.0 12.76 6.33 0.0 4.96 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
156 157 0.036448 TCAGGACGAAGAGACCTCGT 59.964 55.000 0.00 0.00 43.03 4.18
284 285 0.394565 GAGGATGCGGACAGGCTATT 59.605 55.000 0.00 0.00 0.00 1.73
323 324 1.340405 GGAGAGTGCCATGAACCACAT 60.340 52.381 11.77 0.00 40.17 3.21
324 325 2.012673 GAGAGTGCCATGAACCACATC 58.987 52.381 11.77 7.03 37.07 3.06
434 435 4.816109 TGGTCTAGCCAGAGCCAT 57.184 55.556 8.88 0.00 46.68 4.40
550 553 9.806203 CTGATTTAAGGATCATTTGTTATGCAA 57.194 29.630 0.00 0.00 35.62 4.08
623 626 0.392998 CCAACTTGAGGCCGCACTAT 60.393 55.000 9.41 0.00 0.00 2.12
625 628 0.905357 AACTTGAGGCCGCACTATCT 59.095 50.000 9.41 0.00 0.00 1.98
688 691 7.360575 ACGCTTCGAAAGATAAGTATTTTGT 57.639 32.000 0.00 0.00 41.60 2.83
908 911 1.424493 CCGTGAAGGAGAATCAGCGC 61.424 60.000 0.00 0.00 45.00 5.92
942 945 7.117236 GCGGCATATATAGTAAGTGCTTAAACA 59.883 37.037 0.00 0.00 36.15 2.83
943 946 9.151471 CGGCATATATAGTAAGTGCTTAAACAT 57.849 33.333 5.49 0.00 36.15 2.71
1213 1216 0.035630 GTGGAAGATGTCTGCCTGCT 60.036 55.000 8.49 0.00 42.53 4.24
1571 1574 8.488308 AATACCCTCACGGTTATATAAGAACT 57.512 34.615 0.00 0.00 45.36 3.01
1991 1996 6.211384 AGCTTGGCCAAAACTTAAGTCATATT 59.789 34.615 20.91 0.00 0.00 1.28
2182 2209 6.671779 AGGAGAAGGAGAGAAATGTAAGACAT 59.328 38.462 0.00 0.00 41.31 3.06
2394 2421 3.963129 TGTCCTTTTTCTTATCCGGCAT 58.037 40.909 0.00 0.00 0.00 4.40
2400 2427 2.605837 TTCTTATCCGGCATGCGTAA 57.394 45.000 12.44 7.35 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
284 285 1.458486 ACCTCGGAATTGGTGGCAA 59.542 52.632 0.00 0.00 34.90 4.52
340 341 0.231279 GAGAAACAAGCGTCGCGAAA 59.769 50.000 12.06 0.00 0.00 3.46
908 911 2.159421 ACTATATATGCCGCGTCGAAGG 60.159 50.000 4.92 0.00 0.00 3.46
954 957 2.405172 GACTTCTTCGCGGAACTCTTT 58.595 47.619 6.13 0.00 0.00 2.52
968 971 6.655848 AGACATTACTCTGTTAGTCGACTTCT 59.344 38.462 25.44 12.31 39.80 2.85
1213 1216 4.020617 CTCCCTGGCGCCTTGACA 62.021 66.667 29.70 5.44 0.00 3.58
1534 1537 2.100989 GAGGGTATTCGGACACACTCT 58.899 52.381 0.00 0.56 41.18 3.24
1571 1574 0.623031 TGGTCTCCATGCATACCCCA 60.623 55.000 12.76 6.33 0.00 4.96
1751 1755 0.897863 CGCCCCCAGATGTTTTTCCA 60.898 55.000 0.00 0.00 0.00 3.53
1991 1996 9.365906 ACCTTTTATTCACCATTATATGCATCA 57.634 29.630 0.19 0.00 0.00 3.07
2321 2348 5.248248 TCATAATTGACCAAGTCCTGACTGA 59.752 40.000 0.00 0.00 41.58 3.41
2400 2427 3.974871 ACAACGTTGGCGAATTAGTTT 57.025 38.095 30.34 3.54 42.00 2.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.