Multiple sequence alignment - TraesCS5A01G133500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G133500 chr5A 100.000 2723 0 0 1 2723 300074475 300077197 0.000000e+00 5029.0
1 TraesCS5A01G133500 chr5A 99.119 2723 23 1 1 2723 16601427 16598706 0.000000e+00 4894.0
2 TraesCS5A01G133500 chr5A 98.168 2729 42 4 1 2723 600278241 600275515 0.000000e+00 4756.0
3 TraesCS5A01G133500 chr5A 97.836 647 13 1 1702 2348 693487809 693487164 0.000000e+00 1116.0
4 TraesCS5A01G133500 chr5A 96.587 293 5 1 1 288 238790100 238789808 5.270000e-132 481.0
5 TraesCS5A01G133500 chr5A 90.079 252 23 2 1426 1677 6764604 6764853 2.610000e-85 326.0
6 TraesCS5A01G133500 chr5A 98.780 164 0 1 663 826 306571618 306571457 9.540000e-75 291.0
7 TraesCS5A01G133500 chr5A 87.500 176 21 1 1169 1343 534991771 534991596 4.600000e-48 202.0
8 TraesCS5A01G133500 chr5A 98.387 62 1 0 352 413 388849869 388849930 2.870000e-20 110.0
9 TraesCS5A01G133500 chr5A 98.182 55 1 0 2569 2623 570914485 570914539 2.230000e-16 97.1
10 TraesCS5A01G133500 chr5A 100.000 31 0 0 302 332 132592947 132592917 1.050000e-04 58.4
11 TraesCS5A01G133500 chr5A 96.875 32 1 0 531 562 52439914 52439883 1.000000e-03 54.7
12 TraesCS5A01G133500 chr5B 99.339 2723 17 1 1 2723 679660393 679663114 0.000000e+00 4927.0
13 TraesCS5A01G133500 chr7B 99.229 2723 20 1 1 2723 743087695 743090416 0.000000e+00 4911.0
14 TraesCS5A01G133500 chrUn 99.156 2725 20 3 1 2723 189394035 189396758 0.000000e+00 4902.0
15 TraesCS5A01G133500 chr6A 99.155 2723 22 1 1 2723 289130126 289132847 0.000000e+00 4900.0
16 TraesCS5A01G133500 chr7D 98.972 2724 25 3 2 2723 203554849 203552127 0.000000e+00 4872.0
17 TraesCS5A01G133500 chr3B 98.862 2723 29 2 1 2723 92201097 92203817 0.000000e+00 4855.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G133500 chr5A 300074475 300077197 2722 False 5029 5029 100.000 1 2723 1 chr5A.!!$F2 2722
1 TraesCS5A01G133500 chr5A 16598706 16601427 2721 True 4894 4894 99.119 1 2723 1 chr5A.!!$R1 2722
2 TraesCS5A01G133500 chr5A 600275515 600278241 2726 True 4756 4756 98.168 1 2723 1 chr5A.!!$R7 2722
3 TraesCS5A01G133500 chr5A 693487164 693487809 645 True 1116 1116 97.836 1702 2348 1 chr5A.!!$R8 646
4 TraesCS5A01G133500 chr5B 679660393 679663114 2721 False 4927 4927 99.339 1 2723 1 chr5B.!!$F1 2722
5 TraesCS5A01G133500 chr7B 743087695 743090416 2721 False 4911 4911 99.229 1 2723 1 chr7B.!!$F1 2722
6 TraesCS5A01G133500 chrUn 189394035 189396758 2723 False 4902 4902 99.156 1 2723 1 chrUn.!!$F1 2722
7 TraesCS5A01G133500 chr6A 289130126 289132847 2721 False 4900 4900 99.155 1 2723 1 chr6A.!!$F1 2722
8 TraesCS5A01G133500 chr7D 203552127 203554849 2722 True 4872 4872 98.972 2 2723 1 chr7D.!!$R1 2721
9 TraesCS5A01G133500 chr3B 92201097 92203817 2720 False 4855 4855 98.862 1 2723 1 chr3B.!!$F1 2722

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1092 1099 3.462483 TCTCGGTTGTTCTTAACAGCA 57.538 42.857 8.55 0.0 43.43 4.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2511 2521 2.611518 CTCAATGAACCAGACCTCGAC 58.388 52.381 0.0 0.0 0.0 4.2 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1092 1099 3.462483 TCTCGGTTGTTCTTAACAGCA 57.538 42.857 8.55 0.0 43.43 4.41
1179 1186 3.878160 TCGTATGTACATGTTCCTGCA 57.122 42.857 18.81 0.0 0.00 4.41
1212 1219 9.647679 ATGAGTATAGTTATTTATATCGCGACG 57.352 33.333 12.93 0.0 0.00 5.12
1243 1250 4.827284 ACAGTTCCTTGTTCCCATTAACAG 59.173 41.667 0.00 0.0 40.29 3.16
1292 1299 3.404899 GAACCGGTACAGAAATTGGTGA 58.595 45.455 8.00 0.0 0.00 4.02
2156 2165 3.541632 CGTATCACAGGGGTATTTTGCT 58.458 45.455 0.00 0.0 0.00 3.91
2343 2353 5.125900 CACACATCTATTTGAATTCCCTGCA 59.874 40.000 2.27 0.0 0.00 4.41
2367 2377 4.100189 AGTGAAGGATTTCTCGTATGGAGG 59.900 45.833 0.00 0.0 43.34 4.30
2499 2509 1.676678 CCAATCCTCGGAGCGAAGGA 61.677 60.000 0.00 0.0 37.49 3.36
2511 2521 3.485877 GGAGCGAAGGAATGAACGAATTG 60.486 47.826 0.00 0.0 0.00 2.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
15 16 1.437573 CTGTATTGAGAGCGGGCGA 59.562 57.895 0.00 0.0 0.00 5.54
1092 1099 6.263168 CCCGAAGACTTAAATGAATAGCCATT 59.737 38.462 0.00 0.0 38.30 3.16
1212 1219 4.398358 GGGAACAAGGAACTGTTTATAGCC 59.602 45.833 0.00 0.0 40.86 3.93
1243 1250 2.820197 AGCGAAGAAAAAGGGGATGTTC 59.180 45.455 0.00 0.0 0.00 3.18
2343 2353 5.395768 CCTCCATACGAGAAATCCTTCACTT 60.396 44.000 0.00 0.0 41.63 3.16
2367 2377 3.308323 CAGATAGCGCTCAAGAGGTTTTC 59.692 47.826 16.34 0.0 0.00 2.29
2499 2509 3.679980 CAGACCTCGACAATTCGTTCATT 59.320 43.478 0.00 0.0 46.01 2.57
2511 2521 2.611518 CTCAATGAACCAGACCTCGAC 58.388 52.381 0.00 0.0 0.00 4.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.