Multiple sequence alignment - TraesCS5A01G133400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G133400 chr5A 100.000 2528 0 0 1 2528 300048567 300051094 0 4669
1 TraesCS5A01G133400 chr5A 98.655 2528 31 2 4 2528 16623270 16620743 0 4477
2 TraesCS5A01G133400 chr2A 98.774 2529 30 1 1 2528 735172801 735175329 0 4497
3 TraesCS5A01G133400 chr7B 98.735 2530 29 2 1 2528 743066307 743068835 0 4492
4 TraesCS5A01G133400 chr7A 98.655 2528 30 2 1 2528 120828846 120826323 0 4477
5 TraesCS5A01G133400 chr7A 98.418 2529 37 3 1 2528 120925839 120923313 0 4446
6 TraesCS5A01G133400 chr7A 98.419 2530 35 3 1 2528 671960566 671958040 0 4446
7 TraesCS5A01G133400 chr5B 98.378 2527 39 2 2 2528 713046208 713043684 0 4438
8 TraesCS5A01G133400 chr3B 98.379 2529 35 4 1 2528 201635801 201633278 0 4438
9 TraesCS5A01G133400 chr3B 98.631 2046 22 5 487 2528 92179893 92181936 0 3618
10 TraesCS5A01G133400 chr3B 98.581 775 10 1 1 775 92178951 92179724 0 1369


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G133400 chr5A 300048567 300051094 2527 False 4669.0 4669 100.000 1 2528 1 chr5A.!!$F1 2527
1 TraesCS5A01G133400 chr5A 16620743 16623270 2527 True 4477.0 4477 98.655 4 2528 1 chr5A.!!$R1 2524
2 TraesCS5A01G133400 chr2A 735172801 735175329 2528 False 4497.0 4497 98.774 1 2528 1 chr2A.!!$F1 2527
3 TraesCS5A01G133400 chr7B 743066307 743068835 2528 False 4492.0 4492 98.735 1 2528 1 chr7B.!!$F1 2527
4 TraesCS5A01G133400 chr7A 120826323 120828846 2523 True 4477.0 4477 98.655 1 2528 1 chr7A.!!$R1 2527
5 TraesCS5A01G133400 chr7A 120923313 120925839 2526 True 4446.0 4446 98.418 1 2528 1 chr7A.!!$R2 2527
6 TraesCS5A01G133400 chr7A 671958040 671960566 2526 True 4446.0 4446 98.419 1 2528 1 chr7A.!!$R3 2527
7 TraesCS5A01G133400 chr5B 713043684 713046208 2524 True 4438.0 4438 98.378 2 2528 1 chr5B.!!$R1 2526
8 TraesCS5A01G133400 chr3B 201633278 201635801 2523 True 4438.0 4438 98.379 1 2528 1 chr3B.!!$R1 2527
9 TraesCS5A01G133400 chr3B 92178951 92181936 2985 False 2493.5 3618 98.606 1 2528 2 chr3B.!!$F1 2527

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
193 195 1.532437 CACTTTGCAGCAGTTCATCGA 59.468 47.619 0.0 0.0 0.0 3.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2145 2612 3.684408 ACCCTACCCTATTCTCGAACT 57.316 47.619 0.0 0.0 0.0 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
51 52 3.521605 CCGTCCGACTGATGGCTA 58.478 61.111 0.00 0.0 43.13 3.93
143 144 5.478332 CCAGATGGCTTTTCCTAAGAAAGTT 59.522 40.000 0.00 0.0 42.78 2.66
163 165 2.361771 CCTTTCATGGCTGCCCCT 59.638 61.111 17.53 0.0 0.00 4.79
193 195 1.532437 CACTTTGCAGCAGTTCATCGA 59.468 47.619 0.00 0.0 0.00 3.59
1795 2258 4.551603 CGCGAGAATGAATTCCTCATCAAC 60.552 45.833 0.00 0.0 44.43 3.18
2145 2612 0.041833 AGGGTAGAGCTTGGCAGAGA 59.958 55.000 0.00 0.0 0.00 3.10
2198 2666 0.033699 GTCCCCTACCACTAGTCCGT 60.034 60.000 0.00 0.0 0.00 4.69
2320 2788 3.665190 AGAGTAAAGGCGGAAAAGACAG 58.335 45.455 0.00 0.0 0.00 3.51
2346 2814 1.004277 GTGGTCTAATGACAAGGGCCA 59.996 52.381 6.18 0.0 44.61 5.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
51 52 2.102420 TGCGTCGGATCAGATAATGGTT 59.898 45.455 0.0 0.0 0.00 3.67
163 165 1.581934 CTGCAAAGTGAACTGACCGA 58.418 50.000 0.0 0.0 0.00 4.69
2145 2612 3.684408 ACCCTACCCTATTCTCGAACT 57.316 47.619 0.0 0.0 0.00 3.01
2320 2788 4.130118 CCTTGTCATTAGACCACTATGCC 58.870 47.826 0.0 0.0 44.33 4.40
2346 2814 2.987547 TCCCGAGCTTCCGTCGTT 60.988 61.111 0.0 0.0 35.59 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.