Multiple sequence alignment - TraesCS5A01G123100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G123100 chr5A 100.000 2282 0 0 1 2282 268822487 268820206 0 4215
1 TraesCS5A01G123100 chr5A 96.978 2283 66 3 1 2282 268814513 268812233 0 3831
2 TraesCS5A01G123100 chr5A 95.340 751 32 3 1534 2282 29804790 29805539 0 1190
3 TraesCS5A01G123100 chr5A 95.073 751 34 3 1534 2282 29797114 29797863 0 1179
4 TraesCS5A01G123100 chr1A 96.366 2284 76 4 1 2282 201752130 201754408 0 3751
5 TraesCS5A01G123100 chr4A 93.412 2292 134 15 1 2282 85922178 85924462 0 3380
6 TraesCS5A01G123100 chr4A 93.368 2292 136 14 1 2282 85954391 85956676 0 3376
7 TraesCS5A01G123100 chr2A 92.281 2319 135 27 1 2282 352651381 352653692 0 3251
8 TraesCS5A01G123100 chr2A 91.803 2318 146 23 1 2282 352643371 352645680 0 3188
9 TraesCS5A01G123100 chr2A 89.604 1087 80 22 1207 2282 604016772 604017836 0 1351
10 TraesCS5A01G123100 chr2A 88.458 1083 97 18 1207 2282 261452881 261451820 0 1282
11 TraesCS5A01G123100 chr6A 91.765 2210 131 24 1 2175 216935636 216933443 0 3025
12 TraesCS5A01G123100 chr3A 96.131 1344 50 2 14 1355 701989669 701988326 0 2193
13 TraesCS5A01G123100 chr3A 95.238 1344 61 3 14 1355 701981803 701980461 0 2124


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G123100 chr5A 268820206 268822487 2281 True 4215 4215 100.000 1 2282 1 chr5A.!!$R2 2281
1 TraesCS5A01G123100 chr5A 268812233 268814513 2280 True 3831 3831 96.978 1 2282 1 chr5A.!!$R1 2281
2 TraesCS5A01G123100 chr5A 29804790 29805539 749 False 1190 1190 95.340 1534 2282 1 chr5A.!!$F2 748
3 TraesCS5A01G123100 chr5A 29797114 29797863 749 False 1179 1179 95.073 1534 2282 1 chr5A.!!$F1 748
4 TraesCS5A01G123100 chr1A 201752130 201754408 2278 False 3751 3751 96.366 1 2282 1 chr1A.!!$F1 2281
5 TraesCS5A01G123100 chr4A 85922178 85924462 2284 False 3380 3380 93.412 1 2282 1 chr4A.!!$F1 2281
6 TraesCS5A01G123100 chr4A 85954391 85956676 2285 False 3376 3376 93.368 1 2282 1 chr4A.!!$F2 2281
7 TraesCS5A01G123100 chr2A 352651381 352653692 2311 False 3251 3251 92.281 1 2282 1 chr2A.!!$F2 2281
8 TraesCS5A01G123100 chr2A 352643371 352645680 2309 False 3188 3188 91.803 1 2282 1 chr2A.!!$F1 2281
9 TraesCS5A01G123100 chr2A 604016772 604017836 1064 False 1351 1351 89.604 1207 2282 1 chr2A.!!$F3 1075
10 TraesCS5A01G123100 chr2A 261451820 261452881 1061 True 1282 1282 88.458 1207 2282 1 chr2A.!!$R1 1075
11 TraesCS5A01G123100 chr6A 216933443 216935636 2193 True 3025 3025 91.765 1 2175 1 chr6A.!!$R1 2174
12 TraesCS5A01G123100 chr3A 701988326 701989669 1343 True 2193 2193 96.131 14 1355 1 chr3A.!!$R2 1341
13 TraesCS5A01G123100 chr3A 701980461 701981803 1342 True 2124 2124 95.238 14 1355 1 chr3A.!!$R1 1341

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
388 390 1.391933 GCCCATTTTCCTAAGGCCCG 61.392 60.0 0.00 0.0 37.66 6.13 F
1242 1248 0.180406 GGATGCGTCAAGTACCCCAT 59.820 55.0 8.47 0.0 0.00 4.00 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1271 1277 1.052617 TGTGGAACCTCACGGATTCA 58.947 50.000 0.0 0.0 40.31 2.57 R
2062 2126 6.414408 TGGTGCAACAACAATTTTAAACAG 57.586 33.333 0.0 0.0 39.98 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
101 102 4.955335 TCCTAACCCTCACTTCCTATTCA 58.045 43.478 0.00 0.00 0.00 2.57
256 258 8.945057 CCTCCTCTTTCTTTTCTTTCTCTATTG 58.055 37.037 0.00 0.00 0.00 1.90
388 390 1.391933 GCCCATTTTCCTAAGGCCCG 61.392 60.000 0.00 0.00 37.66 6.13
390 392 1.391933 CCATTTTCCTAAGGCCCGGC 61.392 60.000 0.00 0.00 0.00 6.13
452 454 1.628727 CCCATCCCTCTCCCTCTCA 59.371 63.158 0.00 0.00 0.00 3.27
456 458 2.687297 CATCCCTCTCCCTCTCAATCA 58.313 52.381 0.00 0.00 0.00 2.57
1242 1248 0.180406 GGATGCGTCAAGTACCCCAT 59.820 55.000 8.47 0.00 0.00 4.00
1355 1361 1.784856 CACGACGACCTTGTACAACTG 59.215 52.381 3.59 1.45 0.00 3.16
1405 1411 2.028476 CGAAGACCCAAGTACCATGACA 60.028 50.000 0.00 0.00 0.00 3.58
1478 1484 3.488047 CCGATAAGACCGTTGACGTGTAT 60.488 47.826 0.00 0.00 37.74 2.29
1646 1653 0.822944 TCCACTACCACCGTCGTGAA 60.823 55.000 0.00 0.00 43.14 3.18
1767 1774 2.203139 CACCCGTTGTCTGCACCA 60.203 61.111 0.00 0.00 0.00 4.17
1975 2035 1.395826 CCCCTTTTGTTTCCGCCACA 61.396 55.000 0.00 0.00 0.00 4.17
2062 2126 5.041951 TCCGCATCATGTTAACAACTTTC 57.958 39.130 13.23 1.79 0.00 2.62
2192 2261 2.408271 TGCTTCACCTCTTGCCATAG 57.592 50.000 0.00 0.00 0.00 2.23
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
367 369 3.615597 GCCTTAGGAAAATGGGCCT 57.384 52.632 0.69 0.0 37.12 5.19
388 390 1.769465 CTAGGGTTAGGAAAGGAGGCC 59.231 57.143 0.00 0.0 0.00 5.19
390 392 1.769465 GGCTAGGGTTAGGAAAGGAGG 59.231 57.143 0.00 0.0 0.00 4.30
628 632 2.294078 CCTCGGGGTTCCTTGCTCT 61.294 63.158 0.00 0.0 0.00 4.09
634 638 3.470888 CGCATCCTCGGGGTTCCT 61.471 66.667 0.00 0.0 0.00 3.36
1242 1248 3.367743 CGGTCCCGGTCTTGACGA 61.368 66.667 0.00 0.0 35.56 4.20
1271 1277 1.052617 TGTGGAACCTCACGGATTCA 58.947 50.000 0.00 0.0 40.31 2.57
1355 1361 3.479269 CTCGGTTCTTGCGACGGC 61.479 66.667 0.00 0.0 40.52 5.68
1478 1484 4.161565 GGTACACATTCATGGAGTAGGTCA 59.838 45.833 0.00 0.0 0.00 4.02
1646 1653 1.475682 CGTAGAGGGAAGTAGGCGTTT 59.524 52.381 0.00 0.0 0.00 3.60
1726 1733 2.813172 TCTCAAACATCGCAAGCATTCA 59.187 40.909 0.00 0.0 37.18 2.57
1767 1774 2.910688 ACAAGTGACAACTCGGACAT 57.089 45.000 0.00 0.0 34.77 3.06
1975 2035 7.166691 AGAGCATTAAGAAGCATTTGTCATT 57.833 32.000 0.00 0.0 0.00 2.57
2062 2126 6.414408 TGGTGCAACAACAATTTTAAACAG 57.586 33.333 0.00 0.0 39.98 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.