Multiple sequence alignment - TraesCS5A01G117100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G117100 chr5A 100.000 2348 0 0 1 2348 238828024 238830371 0 4337
1 TraesCS5A01G117100 chrUn 98.427 2352 29 5 1 2348 45100795 45098448 0 4132
2 TraesCS5A01G117100 chrUn 98.384 2352 32 5 1 2348 261513061 261515410 0 4128
3 TraesCS5A01G117100 chrUn 98.087 2352 34 6 1 2348 186163782 186161438 0 4084
4 TraesCS5A01G117100 chr5B 98.384 2352 31 4 1 2348 130614904 130612556 0 4126
5 TraesCS5A01G117100 chr5B 98.299 2352 32 5 1 2348 130609880 130607533 0 4115
6 TraesCS5A01G117100 chr5B 98.130 2353 39 4 1 2348 130568752 130571104 0 4096
7 TraesCS5A01G117100 chr3A 98.257 2352 34 5 1 2348 66030310 66032658 0 4109
8 TraesCS5A01G117100 chr7B 98.046 2354 38 4 1 2348 743033697 743036048 0 4085
9 TraesCS5A01G117100 chr2B 98.002 2352 39 6 1 2348 112869116 112866769 0 4076


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G117100 chr5A 238828024 238830371 2347 False 4337.0 4337 100.0000 1 2348 1 chr5A.!!$F1 2347
1 TraesCS5A01G117100 chrUn 45098448 45100795 2347 True 4132.0 4132 98.4270 1 2348 1 chrUn.!!$R1 2347
2 TraesCS5A01G117100 chrUn 261513061 261515410 2349 False 4128.0 4128 98.3840 1 2348 1 chrUn.!!$F1 2347
3 TraesCS5A01G117100 chrUn 186161438 186163782 2344 True 4084.0 4084 98.0870 1 2348 1 chrUn.!!$R2 2347
4 TraesCS5A01G117100 chr5B 130607533 130614904 7371 True 4120.5 4126 98.3415 1 2348 2 chr5B.!!$R1 2347
5 TraesCS5A01G117100 chr5B 130568752 130571104 2352 False 4096.0 4096 98.1300 1 2348 1 chr5B.!!$F1 2347
6 TraesCS5A01G117100 chr3A 66030310 66032658 2348 False 4109.0 4109 98.2570 1 2348 1 chr3A.!!$F1 2347
7 TraesCS5A01G117100 chr7B 743033697 743036048 2351 False 4085.0 4085 98.0460 1 2348 1 chr7B.!!$F1 2347
8 TraesCS5A01G117100 chr2B 112866769 112869116 2347 True 4076.0 4076 98.0020 1 2348 1 chr2B.!!$R1 2347

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
282 283 1.600511 TTACGCCATGCCGACTCTCA 61.601 55.0 1.8 0.0 0.0 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1530 6558 1.379576 GCAGCAGGAGCAAGGGAAT 60.38 57.895 0.0 0.0 45.49 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
51 52 2.167900 GGTGTCCACTAACGGCTATTCT 59.832 50.000 0.00 0.0 0.00 2.40
183 184 5.408356 GTCGCTCCTTTAGTTGAAGTATCA 58.592 41.667 0.00 0.0 0.00 2.15
271 272 3.016736 CCCAATCTTCACTTTACGCCAT 58.983 45.455 0.00 0.0 0.00 4.40
282 283 1.600511 TTACGCCATGCCGACTCTCA 61.601 55.000 1.80 0.0 0.00 3.27
351 353 3.887110 TCTCCCGTATCTTATCTTTCGCA 59.113 43.478 0.00 0.0 0.00 5.10
353 355 3.382227 TCCCGTATCTTATCTTTCGCACA 59.618 43.478 0.00 0.0 0.00 4.57
572 576 9.533253 GGAAAATTCAGACTTTCTTTTTGATGA 57.467 29.630 4.78 0.0 33.06 2.92
907 911 4.263572 CCCGGCCAGAACCACACA 62.264 66.667 2.24 0.0 0.00 3.72
1036 1040 1.992557 AGAACTGGTTAGGAATGGGCA 59.007 47.619 0.00 0.0 0.00 5.36
1091 1095 2.216881 TGATCATGTCCCCTTCCCAAT 58.783 47.619 0.00 0.0 0.00 3.16
1230 1234 4.973396 TCGTCGTATGTATGTTCGACTTT 58.027 39.130 13.09 0.0 46.55 2.66
1326 1330 3.374988 TCCAAGAAGAATTGTGCTATGCG 59.625 43.478 0.00 0.0 0.00 4.73
1415 6443 0.683179 TAACTCCTCGCTAGCTGCCA 60.683 55.000 13.93 0.0 38.78 4.92
1940 6969 4.740934 GCCTAGGTGTTATTACTGAGCTGG 60.741 50.000 11.31 0.0 0.00 4.85
2133 7164 9.527157 TGAAACTAACATTCCATTTCCAGATAA 57.473 29.630 0.00 0.0 0.00 1.75
2282 7316 3.873361 GCGATTTCAGATGTGAATGAGGA 59.127 43.478 6.07 0.0 42.41 3.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
6 7 3.064931 CCACTTTTCACCGGTTAGAGAC 58.935 50.000 2.97 0.00 0.00 3.36
183 184 2.207229 GGCAACGAAAAAGGGGCCT 61.207 57.895 0.84 0.00 38.37 5.19
271 272 1.248101 TTCCACGATGAGAGTCGGCA 61.248 55.000 0.00 0.00 45.49 5.69
282 283 2.844348 ACCCTTGGTCTAATTCCACGAT 59.156 45.455 0.00 0.00 34.45 3.73
351 353 2.621055 GCTGTGTCTCGATCTCCTATGT 59.379 50.000 0.00 0.00 0.00 2.29
353 355 2.158534 AGGCTGTGTCTCGATCTCCTAT 60.159 50.000 0.00 0.00 0.00 2.57
572 576 9.638239 AAAGTTTATGTTTTTATGTGATCGCAT 57.362 25.926 24.23 24.23 0.00 4.73
1036 1040 2.621672 ATCCGGGCTGGGATAGTGGT 62.622 60.000 13.58 0.00 44.97 4.16
1091 1095 3.369052 CGCCCCAAGACAAGATACAACTA 60.369 47.826 0.00 0.00 0.00 2.24
1156 1160 1.977854 AGGGCGGTAGATGATAATGCA 59.022 47.619 0.00 0.00 0.00 3.96
1415 6443 1.589716 CGGTCGGTCCTAGAAACGGT 61.590 60.000 0.00 0.00 0.00 4.83
1530 6558 1.379576 GCAGCAGGAGCAAGGGAAT 60.380 57.895 0.00 0.00 45.49 3.01
1967 6996 2.500229 GAGGAGTAGTCGGAGGATCTG 58.500 57.143 0.00 0.00 44.94 2.90
2118 7149 3.118920 TCGCTCGTTATCTGGAAATGGAA 60.119 43.478 0.00 0.00 0.00 3.53
2282 7316 1.856539 TAGGAAGGGGAGACGACCGT 61.857 60.000 0.00 0.00 0.00 4.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.