Multiple sequence alignment - TraesCS5A01G117000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G117000 chr5A 100.000 2303 0 0 1 2303 238829758 238827456 0 4253
1 TraesCS5A01G117000 chr5A 98.266 2307 36 3 1 2303 238859720 238862026 0 4036
2 TraesCS5A01G117000 chr1A 97.615 2306 50 4 1 2303 334091126 334093429 0 3949
3 TraesCS5A01G117000 chr6B 96.749 2307 65 9 1 2303 388040479 388038179 0 3836
4 TraesCS5A01G117000 chr2D 98.655 2082 24 3 1 2078 644701529 644703610 0 3687
5 TraesCS5A01G117000 chr2D 98.309 414 7 0 1890 2303 17994448 17994035 0 726
6 TraesCS5A01G117000 chr2D 98.068 414 8 0 1890 2303 306157390 306156977 0 721
7 TraesCS5A01G117000 chrUn 98.608 2084 25 3 1 2081 261514797 261512715 0 3685
8 TraesCS5A01G117000 chrUn 98.558 2081 24 3 1 2078 45099061 45101138 0 3672
9 TraesCS5A01G117000 chrUn 98.551 414 6 0 1890 2303 396261046 396261459 0 732
10 TraesCS5A01G117000 chrUn 98.313 415 6 1 1890 2303 209406993 209407407 0 726
11 TraesCS5A01G117000 chr5B 98.558 2081 24 3 1 2078 130613170 130615247 0 3672
12 TraesCS5A01G117000 chr5B 98.318 2081 29 3 1 2078 130608146 130610223 0 3644
13 TraesCS5A01G117000 chr3A 98.273 2084 31 3 1 2081 66032045 66029964 0 3644
14 TraesCS5A01G117000 chr7D 98.551 414 6 0 1890 2303 579000902 579000489 0 732
15 TraesCS5A01G117000 chr1D 98.309 414 7 0 1890 2303 212438990 212438577 0 726


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G117000 chr5A 238827456 238829758 2302 True 4253 4253 100.000 1 2303 1 chr5A.!!$R1 2302
1 TraesCS5A01G117000 chr5A 238859720 238862026 2306 False 4036 4036 98.266 1 2303 1 chr5A.!!$F1 2302
2 TraesCS5A01G117000 chr1A 334091126 334093429 2303 False 3949 3949 97.615 1 2303 1 chr1A.!!$F1 2302
3 TraesCS5A01G117000 chr6B 388038179 388040479 2300 True 3836 3836 96.749 1 2303 1 chr6B.!!$R1 2302
4 TraesCS5A01G117000 chr2D 644701529 644703610 2081 False 3687 3687 98.655 1 2078 1 chr2D.!!$F1 2077
5 TraesCS5A01G117000 chrUn 261512715 261514797 2082 True 3685 3685 98.608 1 2081 1 chrUn.!!$R1 2080
6 TraesCS5A01G117000 chrUn 45099061 45101138 2077 False 3672 3672 98.558 1 2078 1 chrUn.!!$F1 2077
7 TraesCS5A01G117000 chr5B 130608146 130615247 7101 False 3658 3672 98.438 1 2078 2 chr5B.!!$F1 2077
8 TraesCS5A01G117000 chr3A 66029964 66032045 2081 True 3644 3644 98.273 1 2081 1 chr3A.!!$R1 2080

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
204 5229 1.379576 GCAGCAGGAGCAAGGGAAT 60.38 57.895 0.0 0.0 45.49 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1903 6934 1.379642 GCAGCGGATCTCCCCTTTTG 61.38 60.0 0.0 0.0 0.0 2.44 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
204 5229 1.379576 GCAGCAGGAGCAAGGGAAT 60.380 57.895 0.00 0.00 45.49 3.01
319 5344 1.589716 CGGTCGGTCCTAGAAACGGT 61.590 60.000 0.00 0.00 0.00 4.83
578 5604 1.977854 AGGGCGGTAGATGATAATGCA 59.022 47.619 0.00 0.00 0.00 3.96
643 5669 3.369052 CGCCCCAAGACAAGATACAACTA 60.369 47.826 0.00 0.00 0.00 2.24
698 5724 2.621672 ATCCGGGCTGGGATAGTGGT 62.622 60.000 13.58 0.00 44.97 4.16
1162 6190 9.638239 AAAGTTTATGTTTTTATGTGATCGCAT 57.362 25.926 24.23 24.23 0.00 4.73
1381 6411 2.158534 AGGCTGTGTCTCGATCTCCTAT 60.159 50.000 0.00 0.00 0.00 2.57
1452 6482 2.844348 ACCCTTGGTCTAATTCCACGAT 59.156 45.455 0.00 0.00 34.45 3.73
1463 6494 1.248101 TTCCACGATGAGAGTCGGCA 61.248 55.000 0.00 0.00 45.49 5.69
1551 6582 2.207229 GGCAACGAAAAAGGGGCCT 61.207 57.895 0.84 0.00 38.37 5.19
1728 6759 3.064931 CCACTTTTCACCGGTTAGAGAC 58.935 50.000 2.97 0.00 0.00 3.36
1993 7024 9.311916 CTATCTTTCTGATCTCATTCGTTTTCT 57.688 33.333 0.00 0.00 36.65 2.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
319 5344 0.683179 TAACTCCTCGCTAGCTGCCA 60.683 55.000 13.93 0.00 38.78 4.92
408 5434 3.374988 TCCAAGAAGAATTGTGCTATGCG 59.625 43.478 0.00 0.00 0.00 4.73
504 5530 4.973396 TCGTCGTATGTATGTTCGACTTT 58.027 39.130 13.09 0.00 46.55 2.66
643 5669 2.216881 TGATCATGTCCCCTTCCCAAT 58.783 47.619 0.00 0.00 0.00 3.16
698 5724 1.992557 AGAACTGGTTAGGAATGGGCA 59.007 47.619 0.00 0.00 0.00 5.36
1162 6190 9.533253 GGAAAATTCAGACTTTCTTTTTGATGA 57.467 29.630 4.78 0.00 33.06 2.92
1381 6411 3.382227 TCCCGTATCTTATCTTTCGCACA 59.618 43.478 0.00 0.00 0.00 4.57
1452 6482 1.600511 TTACGCCATGCCGACTCTCA 61.601 55.000 1.80 0.00 0.00 3.27
1463 6494 3.016736 CCCAATCTTCACTTTACGCCAT 58.983 45.455 0.00 0.00 0.00 4.40
1551 6582 5.408356 GTCGCTCCTTTAGTTGAAGTATCA 58.592 41.667 0.00 0.00 0.00 2.15
1683 6714 2.167900 GGTGTCCACTAACGGCTATTCT 59.832 50.000 0.00 0.00 0.00 2.40
1903 6934 1.379642 GCAGCGGATCTCCCCTTTTG 61.380 60.000 0.00 0.00 0.00 2.44
1993 7024 6.762661 TGATCTCATGACTTTTTATGCGATCA 59.237 34.615 12.99 12.99 45.66 2.92
2274 7305 7.875327 AAATAATCTAAACATGCGGGTAAGT 57.125 32.000 0.00 0.00 0.00 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.