Multiple sequence alignment - TraesCS5A01G116900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G116900 chr5A 100.000 2439 0 0 1 2439 238821206 238823644 0 4505
1 TraesCS5A01G116900 chr5A 98.324 2447 23 5 1 2439 19247241 19249677 0 4276
2 TraesCS5A01G116900 chr7D 98.566 2441 24 4 1 2439 381925603 381923172 0 4303
3 TraesCS5A01G116900 chr7D 98.444 2442 23 3 1 2439 382051681 382049252 0 4285
4 TraesCS5A01G116900 chr7D 98.362 2442 26 4 1 2439 203501601 203499171 0 4276
5 TraesCS5A01G116900 chr7D 98.238 2441 23 5 1 2439 381972168 381974590 0 4252
6 TraesCS5A01G116900 chr6D 98.402 2441 26 4 1 2439 124519124 124516695 0 4279
7 TraesCS5A01G116900 chr1A 98.157 2442 29 4 1 2439 498689625 498692053 0 4246
8 TraesCS5A01G116900 chr1D 97.870 2441 37 10 1 2439 269408402 269405975 0 4205
9 TraesCS5A01G116900 chr4A 97.827 2439 44 4 1 2439 246657024 246659453 0 4202
10 TraesCS5A01G116900 chr4A 97.419 2441 51 7 1 2439 67598379 67595949 0 4148
11 TraesCS5A01G116900 chr7A 96.639 2440 71 6 1 2439 686649180 686651609 0 4041


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G116900 chr5A 238821206 238823644 2438 False 4505 4505 100.000 1 2439 1 chr5A.!!$F2 2438
1 TraesCS5A01G116900 chr5A 19247241 19249677 2436 False 4276 4276 98.324 1 2439 1 chr5A.!!$F1 2438
2 TraesCS5A01G116900 chr7D 381923172 381925603 2431 True 4303 4303 98.566 1 2439 1 chr7D.!!$R2 2438
3 TraesCS5A01G116900 chr7D 382049252 382051681 2429 True 4285 4285 98.444 1 2439 1 chr7D.!!$R3 2438
4 TraesCS5A01G116900 chr7D 203499171 203501601 2430 True 4276 4276 98.362 1 2439 1 chr7D.!!$R1 2438
5 TraesCS5A01G116900 chr7D 381972168 381974590 2422 False 4252 4252 98.238 1 2439 1 chr7D.!!$F1 2438
6 TraesCS5A01G116900 chr6D 124516695 124519124 2429 True 4279 4279 98.402 1 2439 1 chr6D.!!$R1 2438
7 TraesCS5A01G116900 chr1A 498689625 498692053 2428 False 4246 4246 98.157 1 2439 1 chr1A.!!$F1 2438
8 TraesCS5A01G116900 chr1D 269405975 269408402 2427 True 4205 4205 97.870 1 2439 1 chr1D.!!$R1 2438
9 TraesCS5A01G116900 chr4A 246657024 246659453 2429 False 4202 4202 97.827 1 2439 1 chr4A.!!$F1 2438
10 TraesCS5A01G116900 chr4A 67595949 67598379 2430 True 4148 4148 97.419 1 2439 1 chr4A.!!$R1 2438
11 TraesCS5A01G116900 chr7A 686649180 686651609 2429 False 4041 4041 96.639 1 2439 1 chr7A.!!$F1 2438

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
125 126 0.178973 AAGTAAGCCCCACAACCCAC 60.179 55.0 0.0 0.0 0.0 4.61 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1554 1559 1.271652 TGCCAACGAAATGAAGGCCTA 60.272 47.619 5.16 0.0 44.6 3.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
57 58 2.025887 CCTTACTCATGGCAACCTTCCT 60.026 50.000 0.00 0.00 0.00 3.36
125 126 0.178973 AAGTAAGCCCCACAACCCAC 60.179 55.000 0.00 0.00 0.00 4.61
229 230 4.593206 AGGTCATAGCCGAAATAGGATTCA 59.407 41.667 0.00 0.00 0.00 2.57
253 254 1.153168 GCTAGAGCGCCCAAATCCA 60.153 57.895 2.29 0.00 0.00 3.41
453 454 1.814772 CTTTCGTTTGGGCCATGGCA 61.815 55.000 36.56 16.33 44.11 4.92
1054 1055 5.745294 CCGGAATTCTTTATTAGAACGTCGA 59.255 40.000 5.23 0.00 45.33 4.20
1554 1559 1.077429 GAAGCATTCGGAAGGGGCT 60.077 57.895 4.43 6.53 34.17 5.19
2056 2071 2.260822 AGGCAGGCTTCTTTCAGTAGA 58.739 47.619 0.00 0.00 0.00 2.59
2235 2250 1.953686 CCGGGAGAAAAAGTGAAAGCA 59.046 47.619 0.00 0.00 0.00 3.91
2277 2292 1.469335 AACCCTCGGAAGCGAAGACA 61.469 55.000 0.00 0.00 0.00 3.41
2349 2365 1.543802 CATAAAGCCGCCAAGGAAACA 59.456 47.619 0.00 0.00 45.00 2.83
2374 2390 3.762407 TCGTTCCCTTTCATCAAGTGA 57.238 42.857 0.00 0.00 34.25 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
125 126 1.999735 TCTATTTGTTCTTCGCCGCTG 59.000 47.619 0.00 0.0 0.00 5.18
253 254 5.529800 GGCAAACCCGTGTCAAATATATAGT 59.470 40.000 0.00 0.0 0.00 2.12
793 794 3.436015 TGGAAAACAACTTTCACGTTCGA 59.564 39.130 0.00 0.0 44.61 3.71
1554 1559 1.271652 TGCCAACGAAATGAAGGCCTA 60.272 47.619 5.16 0.0 44.60 3.93
1784 1792 5.136068 TCTCTCTCTCTCTCTCTCTCTCT 57.864 47.826 0.00 0.0 0.00 3.10
1785 1793 4.261994 GCTCTCTCTCTCTCTCTCTCTCTC 60.262 54.167 0.00 0.0 0.00 3.20
1786 1794 3.640967 GCTCTCTCTCTCTCTCTCTCTCT 59.359 52.174 0.00 0.0 0.00 3.10
1787 1795 3.386078 TGCTCTCTCTCTCTCTCTCTCTC 59.614 52.174 0.00 0.0 0.00 3.20
1788 1796 3.378512 TGCTCTCTCTCTCTCTCTCTCT 58.621 50.000 0.00 0.0 0.00 3.10
1789 1797 3.386078 TCTGCTCTCTCTCTCTCTCTCTC 59.614 52.174 0.00 0.0 0.00 3.20
2056 2071 5.046663 AGCCCGGTGAAAATGAATATGTTTT 60.047 36.000 0.00 0.0 0.00 2.43
2235 2250 1.270147 GGTATAGGCCGTTTCGAGCAT 60.270 52.381 0.00 0.0 0.00 3.79
2349 2365 4.887655 ACTTGATGAAAGGGAACGAACTTT 59.112 37.500 0.00 0.0 40.51 2.66
2374 2390 5.557866 CTTAAGTGGTTTGCCTACCTTACT 58.442 41.667 5.98 0.0 39.04 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.