Multiple sequence alignment - TraesCS5A01G116800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G116800 chr5A 100.000 2594 0 0 1 2594 238822841 238820248 0 4791
1 TraesCS5A01G116800 chr5A 98.998 2596 24 1 1 2594 19248878 19246283 0 4649
2 TraesCS5A01G116800 chr7D 98.921 2595 27 1 1 2594 381923967 381926561 0 4636
3 TraesCS5A01G116800 chr7D 98.883 2596 27 1 1 2594 382050044 382052639 0 4632
4 TraesCS5A01G116800 chr7D 98.844 2595 29 1 1 2594 203499965 203502559 0 4625
5 TraesCS5A01G116800 chr7D 98.654 2600 26 3 1 2594 381973801 381971205 0 4599
6 TraesCS5A01G116800 chr1A 98.497 2595 33 2 1 2594 498691261 498688672 0 4571
7 TraesCS5A01G116800 chr4A 97.687 2594 57 3 1 2594 246658657 246656067 0 4455


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G116800 chr5A 238820248 238822841 2593 True 4791 4791 100.000 1 2594 1 chr5A.!!$R2 2593
1 TraesCS5A01G116800 chr5A 19246283 19248878 2595 True 4649 4649 98.998 1 2594 1 chr5A.!!$R1 2593
2 TraesCS5A01G116800 chr7D 381923967 381926561 2594 False 4636 4636 98.921 1 2594 1 chr7D.!!$F2 2593
3 TraesCS5A01G116800 chr7D 382050044 382052639 2595 False 4632 4632 98.883 1 2594 1 chr7D.!!$F3 2593
4 TraesCS5A01G116800 chr7D 203499965 203502559 2594 False 4625 4625 98.844 1 2594 1 chr7D.!!$F1 2593
5 TraesCS5A01G116800 chr7D 381971205 381973801 2596 True 4599 4599 98.654 1 2594 1 chr7D.!!$R1 2593
6 TraesCS5A01G116800 chr1A 498688672 498691261 2589 True 4571 4571 98.497 1 2594 1 chr1A.!!$R1 2593
7 TraesCS5A01G116800 chr4A 246656067 246658657 2590 True 4455 4455 97.687 1 2594 1 chr4A.!!$R1 2593

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
81 82 1.271652 TGCCAACGAAATGAAGGCCTA 60.272 47.619 5.16 0.0 44.60 3.93 F
842 845 3.436015 TGGAAAACAACTTTCACGTTCGA 59.564 39.130 0.00 0.0 44.61 3.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1510 1516 0.178973 AAGTAAGCCCCACAACCCAC 60.179 55.0 0.0 0.0 0.0 4.61 R
2304 2315 0.322975 AGCAGAGCCGTTTCATGAGT 59.677 50.0 0.0 0.0 0.0 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
81 82 1.271652 TGCCAACGAAATGAAGGCCTA 60.272 47.619 5.16 0.00 44.60 3.93
842 845 3.436015 TGGAAAACAACTTTCACGTTCGA 59.564 39.130 0.00 0.00 44.61 3.71
1382 1388 5.529800 GGCAAACCCGTGTCAAATATATAGT 59.470 40.000 0.00 0.00 0.00 2.12
1510 1516 1.999735 TCTATTTGTTCTTCGCCGCTG 59.000 47.619 0.00 0.00 0.00 5.18
1690 1696 3.485877 GGAATGCATGCTACGAAAGACAC 60.486 47.826 20.33 0.00 0.00 3.67
1715 1721 3.442625 TCGAGTCTGATACATCAACCGTT 59.557 43.478 0.00 0.00 36.18 4.44
1816 1822 5.421374 GTGTAATAGGACTCCCAGTTACTGT 59.579 44.000 11.68 0.00 36.42 3.55
1818 1824 2.400467 AGGACTCCCAGTTACTGTGT 57.600 50.000 11.68 7.06 33.88 3.72
2026 2032 1.143684 CCATCCGAACCCTCCAATGAT 59.856 52.381 0.00 0.00 0.00 2.45
2084 2090 4.776322 CATGCGGAAGGGGCACGA 62.776 66.667 0.00 0.00 44.23 4.35
2371 2382 0.534412 CCGAAGCACTGGAGTGATCT 59.466 55.000 11.06 0.00 44.74 2.75
2450 2461 4.634012 ACACATTTACAGAGCTTACCCA 57.366 40.909 0.00 0.00 0.00 4.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
81 82 1.077429 GAAGCATTCGGAAGGGGCT 60.077 57.895 4.43 6.53 34.17 5.19
581 584 5.745294 CCGGAATTCTTTATTAGAACGTCGA 59.255 40.000 5.23 0.00 45.33 4.20
1182 1188 1.814772 CTTTCGTTTGGGCCATGGCA 61.815 55.000 36.56 16.33 44.11 4.92
1382 1388 1.153168 GCTAGAGCGCCCAAATCCA 60.153 57.895 2.29 0.00 0.00 3.41
1406 1412 4.593206 AGGTCATAGCCGAAATAGGATTCA 59.407 41.667 0.00 0.00 0.00 2.57
1510 1516 0.178973 AAGTAAGCCCCACAACCCAC 60.179 55.000 0.00 0.00 0.00 4.61
1578 1584 2.025887 CCTTACTCATGGCAACCTTCCT 60.026 50.000 0.00 0.00 0.00 3.36
1690 1696 3.364062 GTTGATGTATCAGACTCGACCG 58.636 50.000 0.00 0.00 38.19 4.79
1715 1721 4.533815 ACTCGTACAAGGATATGGAGTCA 58.466 43.478 0.00 0.00 0.00 3.41
1816 1822 2.032924 CACCTCAGTATACGATCGCACA 59.967 50.000 16.60 0.37 0.00 4.57
1818 1824 1.001706 GCACCTCAGTATACGATCGCA 60.002 52.381 16.60 1.53 0.00 5.10
2026 2032 3.935203 CGCTTTGCTCTCCTCTTATTTCA 59.065 43.478 0.00 0.00 0.00 2.69
2084 2090 5.074515 TCTCCCCCACACTTCTTTATTTCTT 59.925 40.000 0.00 0.00 0.00 2.52
2304 2315 0.322975 AGCAGAGCCGTTTCATGAGT 59.677 50.000 0.00 0.00 0.00 3.41
2371 2382 2.445274 GCCCCTTCCCGGCTACTA 60.445 66.667 0.00 0.00 43.48 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.