Multiple sequence alignment - TraesCS5A01G116700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G116700 chr5A 100.000 2718 0 0 1 2718 238819336 238822053 0 5020
1 TraesCS5A01G116700 chr5A 99.007 2720 25 1 1 2718 19245369 19248088 0 4872
2 TraesCS5A01G116700 chr7D 99.007 2718 27 0 1 2718 382053551 382050834 0 4870
3 TraesCS5A01G116700 chr7D 98.821 2715 32 0 4 2718 381927470 381924756 0 4837
4 TraesCS5A01G116700 chr7D 98.749 2718 34 0 1 2718 203503471 203500754 0 4831
5 TraesCS5A01G116700 chr7D 98.568 2724 30 3 1 2718 381970292 381973012 0 4806
6 TraesCS5A01G116700 chr7A 98.492 2719 35 2 1 2718 60282781 60280068 0 4789


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G116700 chr5A 238819336 238822053 2717 False 5020 5020 100.000 1 2718 1 chr5A.!!$F2 2717
1 TraesCS5A01G116700 chr5A 19245369 19248088 2719 False 4872 4872 99.007 1 2718 1 chr5A.!!$F1 2717
2 TraesCS5A01G116700 chr7D 382050834 382053551 2717 True 4870 4870 99.007 1 2718 1 chr7D.!!$R3 2717
3 TraesCS5A01G116700 chr7D 381924756 381927470 2714 True 4837 4837 98.821 4 2718 1 chr7D.!!$R2 2714
4 TraesCS5A01G116700 chr7D 203500754 203503471 2717 True 4831 4831 98.749 1 2718 1 chr7D.!!$R1 2717
5 TraesCS5A01G116700 chr7D 381970292 381973012 2720 False 4806 4806 98.568 1 2718 1 chr7D.!!$F1 2717
6 TraesCS5A01G116700 chr7A 60280068 60282781 2713 True 4789 4789 98.492 1 2718 1 chr7A.!!$R1 2717

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
797 801 2.817258 TCTGTTTTGCCCACTTTATCCG 59.183 45.455 0.0 0.0 0.0 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1995 2009 1.999735 TCTATTTGTTCTTCGCCGCTG 59.0 47.619 0.0 0.0 0.0 5.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
114 115 6.605995 TCAATCCTTTAATCGGAGACTAGACA 59.394 38.462 0.00 0.00 42.51 3.41
117 118 5.950549 TCCTTTAATCGGAGACTAGACAAGT 59.049 40.000 0.00 0.00 42.51 3.16
797 801 2.817258 TCTGTTTTGCCCACTTTATCCG 59.183 45.455 0.00 0.00 0.00 4.18
1134 1143 2.445274 GCCCCTTCCCGGCTACTA 60.445 66.667 0.00 0.00 43.48 1.82
1201 1210 0.322975 AGCAGAGCCGTTTCATGAGT 59.677 50.000 0.00 0.00 0.00 3.41
1421 1435 5.074515 TCTCCCCCACACTTCTTTATTTCTT 59.925 40.000 0.00 0.00 0.00 2.52
1479 1493 3.935203 CGCTTTGCTCTCCTCTTATTTCA 59.065 43.478 0.00 0.00 0.00 2.69
1687 1701 1.001706 GCACCTCAGTATACGATCGCA 60.002 52.381 16.60 1.53 0.00 5.10
1689 1703 2.032924 CACCTCAGTATACGATCGCACA 59.967 50.000 16.60 0.37 0.00 4.57
1790 1804 4.533815 ACTCGTACAAGGATATGGAGTCA 58.466 43.478 0.00 0.00 0.00 3.41
1815 1829 3.364062 GTTGATGTATCAGACTCGACCG 58.636 50.000 0.00 0.00 38.19 4.79
1874 1888 2.751259 TGATTCGGTAAGCTACGTGTCT 59.249 45.455 0.00 0.00 0.00 3.41
1927 1941 2.025887 CCTTACTCATGGCAACCTTCCT 60.026 50.000 0.00 0.00 0.00 3.36
1995 2009 0.178973 AAGTAAGCCCCACAACCCAC 60.179 55.000 0.00 0.00 0.00 4.61
2099 2113 4.593206 AGGTCATAGCCGAAATAGGATTCA 59.407 41.667 0.00 0.00 0.00 2.57
2123 2137 1.153168 GCTAGAGCGCCCAAATCCA 60.153 57.895 2.29 0.00 0.00 3.41
2323 2337 1.814772 CTTTCGTTTGGGCCATGGCA 61.815 55.000 36.56 16.33 44.11 4.92
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
82 83 4.345837 TCCGATTAAAGGATTGATACGGGT 59.654 41.667 0.00 0.00 38.62 5.28
114 115 4.658901 TCTCCTTTGTCCTTCCTAACACTT 59.341 41.667 0.00 0.00 0.00 3.16
117 118 3.971305 TGTCTCCTTTGTCCTTCCTAACA 59.029 43.478 0.00 0.00 0.00 2.41
797 801 5.310409 TGATCATTTTGATAGAGGGGGAC 57.690 43.478 0.00 0.00 37.20 4.46
1055 1059 4.634012 ACACATTTACAGAGCTTACCCA 57.366 40.909 0.00 0.00 0.00 4.51
1134 1143 0.534412 CCGAAGCACTGGAGTGATCT 59.466 55.000 11.06 0.00 44.74 2.75
1421 1435 4.776322 CATGCGGAAGGGGCACGA 62.776 66.667 0.00 0.00 44.23 4.35
1479 1493 1.143684 CCATCCGAACCCTCCAATGAT 59.856 52.381 0.00 0.00 0.00 2.45
1687 1701 2.400467 AGGACTCCCAGTTACTGTGT 57.600 50.000 11.68 7.06 33.88 3.72
1689 1703 5.421374 GTGTAATAGGACTCCCAGTTACTGT 59.579 44.000 11.68 0.00 36.42 3.55
1790 1804 3.442625 TCGAGTCTGATACATCAACCGTT 59.557 43.478 0.00 0.00 36.18 4.44
1815 1829 3.485877 GGAATGCATGCTACGAAAGACAC 60.486 47.826 20.33 0.00 0.00 3.67
1874 1888 2.485795 GGCAGTTTTCCGTGCACCA 61.486 57.895 12.15 0.00 41.75 4.17
1995 2009 1.999735 TCTATTTGTTCTTCGCCGCTG 59.000 47.619 0.00 0.00 0.00 5.18
2123 2137 5.529800 GGCAAACCCGTGTCAAATATATAGT 59.470 40.000 0.00 0.00 0.00 2.12
2663 2677 3.436015 TGGAAAACAACTTTCACGTTCGA 59.564 39.130 0.00 0.00 44.61 3.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.