Multiple sequence alignment - TraesCS5A01G110500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G110500 chr5A 100.000 2411 0 0 1 2411 210234341 210231931 0.000000e+00 4453
1 TraesCS5A01G110500 chr5A 96.227 2412 85 6 1 2411 213233845 213231439 0.000000e+00 3945
2 TraesCS5A01G110500 chr5A 95.524 2413 103 5 1 2411 147590626 147593035 0.000000e+00 3853
3 TraesCS5A01G110500 chr5A 85.779 443 45 9 67 494 35913222 35913661 1.020000e-123 453
4 TraesCS5A01G110500 chr1A 96.888 2410 73 2 3 2411 147728734 147726326 0.000000e+00 4034
5 TraesCS5A01G110500 chr6A 94.552 2423 105 10 8 2411 206133921 206136335 0.000000e+00 3718
6 TraesCS5A01G110500 chr4D 93.757 1842 93 6 8 1832 215033701 215035537 0.000000e+00 2745
7 TraesCS5A01G110500 chr4D 93.878 1029 57 5 1389 2411 313783419 313782391 0.000000e+00 1546
8 TraesCS5A01G110500 chr4D 86.674 938 86 24 489 1391 15874836 15873903 0.000000e+00 1003
9 TraesCS5A01G110500 chr4D 92.411 593 34 5 1822 2411 215046728 215047312 0.000000e+00 835
10 TraesCS5A01G110500 chr4D 89.938 487 39 4 8 494 313784377 313783901 9.470000e-174 619
11 TraesCS5A01G110500 chr2A 91.918 1027 73 9 1389 2411 402113211 402114231 0.000000e+00 1428
12 TraesCS5A01G110500 chr2A 91.723 1027 75 9 1389 2411 404058329 404059349 0.000000e+00 1417
13 TraesCS5A01G110500 chr2A 82.488 434 42 12 93 494 404057436 404057867 1.370000e-92 350
14 TraesCS5A01G110500 chr2A 82.028 434 44 12 93 494 402112318 402112749 2.970000e-89 339
15 TraesCS5A01G110500 chr7A 91.642 1029 74 10 1389 2411 195277216 195276194 0.000000e+00 1413
16 TraesCS5A01G110500 chr4B 85.472 943 86 24 489 1391 27398917 27397986 0.000000e+00 935
17 TraesCS5A01G110500 chr4A 92.181 486 32 4 910 1391 584697312 584696829 0.000000e+00 682
18 TraesCS5A01G110500 chr3A 88.600 500 43 5 8 494 281209276 281208778 1.600000e-166 595
19 TraesCS5A01G110500 chr3B 77.266 717 115 27 690 1391 824261329 824260646 6.290000e-101 377
20 TraesCS5A01G110500 chr3B 77.465 710 107 32 661 1354 822552226 822552898 2.260000e-100 375
21 TraesCS5A01G110500 chr3D 84.179 335 30 2 8 342 604116839 604116528 1.080000e-78 303


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G110500 chr5A 210231931 210234341 2410 True 4453.0 4453 100.0000 1 2411 1 chr5A.!!$R1 2410
1 TraesCS5A01G110500 chr5A 213231439 213233845 2406 True 3945.0 3945 96.2270 1 2411 1 chr5A.!!$R2 2410
2 TraesCS5A01G110500 chr5A 147590626 147593035 2409 False 3853.0 3853 95.5240 1 2411 1 chr5A.!!$F2 2410
3 TraesCS5A01G110500 chr1A 147726326 147728734 2408 True 4034.0 4034 96.8880 3 2411 1 chr1A.!!$R1 2408
4 TraesCS5A01G110500 chr6A 206133921 206136335 2414 False 3718.0 3718 94.5520 8 2411 1 chr6A.!!$F1 2403
5 TraesCS5A01G110500 chr4D 215033701 215035537 1836 False 2745.0 2745 93.7570 8 1832 1 chr4D.!!$F1 1824
6 TraesCS5A01G110500 chr4D 313782391 313784377 1986 True 1082.5 1546 91.9080 8 2411 2 chr4D.!!$R2 2403
7 TraesCS5A01G110500 chr4D 15873903 15874836 933 True 1003.0 1003 86.6740 489 1391 1 chr4D.!!$R1 902
8 TraesCS5A01G110500 chr4D 215046728 215047312 584 False 835.0 835 92.4110 1822 2411 1 chr4D.!!$F2 589
9 TraesCS5A01G110500 chr2A 402112318 402114231 1913 False 883.5 1428 86.9730 93 2411 2 chr2A.!!$F1 2318
10 TraesCS5A01G110500 chr2A 404057436 404059349 1913 False 883.5 1417 87.1055 93 2411 2 chr2A.!!$F2 2318
11 TraesCS5A01G110500 chr7A 195276194 195277216 1022 True 1413.0 1413 91.6420 1389 2411 1 chr7A.!!$R1 1022
12 TraesCS5A01G110500 chr4B 27397986 27398917 931 True 935.0 935 85.4720 489 1391 1 chr4B.!!$R1 902
13 TraesCS5A01G110500 chr3B 824260646 824261329 683 True 377.0 377 77.2660 690 1391 1 chr3B.!!$R1 701
14 TraesCS5A01G110500 chr3B 822552226 822552898 672 False 375.0 375 77.4650 661 1354 1 chr3B.!!$F1 693

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
650 1059 1.284785 GACAAGAATCACCCATCCCCA 59.715 52.381 0.0 0.0 0.0 4.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1546 1998 3.246167 TGGCTAAATGGGTAAAATGGGGT 60.246 43.478 0.0 0.0 0.0 4.95 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
157 158 2.125952 CTGCTCCACATCGCGTCA 60.126 61.111 5.77 0.0 0.00 4.35
177 179 4.082523 CCACCGTCGTGATGCCCT 62.083 66.667 0.00 0.0 43.14 5.19
600 999 2.099592 ACAACAAGTTGCAGGTGTCATG 59.900 45.455 12.54 0.0 44.03 3.07
650 1059 1.284785 GACAAGAATCACCCATCCCCA 59.715 52.381 0.00 0.0 0.00 4.96
1546 1998 0.897401 TCCACCGCATTGCCATTTGA 60.897 50.000 2.41 0.0 0.00 2.69
1665 2117 2.350388 GGGCGTCTGTGTAATGTTTGTG 60.350 50.000 0.00 0.0 0.00 3.33
2014 2478 7.051000 CCCTCTTTAAGAAATCCTAGAGGTTG 58.949 42.308 13.26 0.0 44.62 3.77
2146 2612 8.336801 AGAAGTTCAAATTTAAATAGCGGAGT 57.663 30.769 5.50 0.0 0.00 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
157 158 2.261671 GCATCACGACGGTGGACT 59.738 61.111 0.00 0.00 44.50 3.85
177 179 1.302511 GGGAAAGCAGGCGAGTTCA 60.303 57.895 0.00 0.00 0.00 3.18
261 276 3.390521 ACCTTGCGAGCCGGATCA 61.391 61.111 21.44 0.00 0.00 2.92
526 925 8.299262 TGTACGAACTAGTCCGTTATATCTAC 57.701 38.462 13.77 3.35 39.86 2.59
650 1059 2.620779 CGAGAGATTCGGATATGCGT 57.379 50.000 16.54 0.00 45.54 5.24
705 1119 7.151308 TGGTAAACAATAGAAAAGTTGGCATG 58.849 34.615 0.00 0.00 0.00 4.06
1167 1612 1.074699 ACGGGGATAGGGGAGTTCC 60.075 63.158 0.00 0.00 0.00 3.62
1546 1998 3.246167 TGGCTAAATGGGTAAAATGGGGT 60.246 43.478 0.00 0.00 0.00 4.95
1665 2117 9.237846 CTGAACTTCCATTTTCTTTACAAGTTC 57.762 33.333 12.58 12.58 44.33 3.01
1991 2455 9.726438 TTTCAACCTCTAGGATTTCTTAAAGAG 57.274 33.333 2.23 0.00 38.94 2.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.