Multiple sequence alignment - TraesCS5A01G106600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G106600 chr5A 100.000 2237 0 0 1 2237 176770801 176768565 0.000000e+00 4132.0
1 TraesCS5A01G106600 chr5A 93.506 1740 92 6 1 1722 176765724 176767460 0.000000e+00 2567.0
2 TraesCS5A01G106600 chr5A 94.140 529 30 1 1710 2237 343679984 343679456 0.000000e+00 804.0
3 TraesCS5A01G106600 chr5A 92.571 350 21 5 1362 1708 621684578 621684925 4.290000e-137 497.0
4 TraesCS5A01G106600 chr5A 89.757 371 24 2 714 1071 275892842 275893211 1.570000e-126 462.0
5 TraesCS5A01G106600 chr5A 88.251 366 30 1 714 1066 135504002 135503637 2.050000e-115 425.0
6 TraesCS5A01G106600 chr5A 93.365 211 10 2 1 211 326123603 326123397 2.160000e-80 309.0
7 TraesCS5A01G106600 chr5A 92.063 63 3 2 324 386 291457874 291457934 1.100000e-13 87.9
8 TraesCS5A01G106600 chr5A 92.063 63 3 2 324 386 291465971 291466031 1.100000e-13 87.9
9 TraesCS5A01G106600 chr6A 93.260 1736 98 6 1 1722 394314461 394316191 0.000000e+00 2540.0
10 TraesCS5A01G106600 chr6A 92.122 1739 113 9 1 1722 394306433 394308164 0.000000e+00 2431.0
11 TraesCS5A01G106600 chr6A 93.951 529 30 2 1710 2237 256230862 256231389 0.000000e+00 798.0
12 TraesCS5A01G106600 chr6A 88.046 435 38 6 921 1341 297592511 297592077 9.220000e-139 503.0
13 TraesCS5A01G106600 chr6A 91.111 360 26 6 1362 1717 85038939 85039296 1.200000e-132 483.0
14 TraesCS5A01G106600 chr6A 88.679 371 28 2 714 1071 131497685 131497316 7.330000e-120 440.0
15 TraesCS5A01G106600 chr6A 89.340 197 20 1 608 803 39286075 39286271 1.720000e-61 246.0
16 TraesCS5A01G106600 chr6A 87.368 95 9 3 182 275 475129614 475129522 3.040000e-19 106.0
17 TraesCS5A01G106600 chr6A 84.848 99 3 6 296 386 256225464 256225370 3.060000e-14 89.8
18 TraesCS5A01G106600 chr6A 84.848 99 3 6 296 386 256233791 256233697 3.060000e-14 89.8
19 TraesCS5A01G106600 chr7A 92.140 827 52 2 715 1528 198236865 198237691 0.000000e+00 1155.0
20 TraesCS5A01G106600 chr7A 91.536 827 57 1 715 1528 198244729 198245555 0.000000e+00 1127.0
21 TraesCS5A01G106600 chr7A 94.184 533 27 2 1709 2237 273564616 273565148 0.000000e+00 809.0
22 TraesCS5A01G106600 chr7A 91.389 360 25 6 1362 1717 521471913 521472270 2.580000e-134 488.0
23 TraesCS5A01G106600 chr7A 90.278 360 29 6 1362 1717 346863043 346863400 1.210000e-127 466.0
24 TraesCS5A01G106600 chr7A 92.417 211 10 3 1 211 352748791 352748995 1.680000e-76 296.0
25 TraesCS5A01G106600 chr7A 92.417 211 10 3 1 211 352756996 352757200 1.680000e-76 296.0
26 TraesCS5A01G106600 chr2A 89.460 778 67 3 608 1371 257026913 257026137 0.000000e+00 968.0
27 TraesCS5A01G106600 chr2A 94.528 530 28 1 1709 2237 260045332 260045861 0.000000e+00 817.0
28 TraesCS5A01G106600 chr2A 89.627 482 36 3 905 1373 257034653 257034173 3.180000e-168 601.0
29 TraesCS5A01G106600 chr2A 89.641 251 20 6 1471 1717 86576223 86576471 4.640000e-82 315.0
30 TraesCS5A01G106600 chr2A 93.839 211 9 2 1 211 542611829 542611623 4.640000e-82 315.0
31 TraesCS5A01G106600 chr2A 89.868 227 10 10 199 424 424495999 424495785 1.690000e-71 279.0
32 TraesCS5A01G106600 chr2A 95.930 172 6 1 254 424 424475257 424475086 6.080000e-71 278.0
33 TraesCS5A01G106600 chr4A 94.528 530 28 1 1709 2237 294131667 294132196 0.000000e+00 817.0
34 TraesCS5A01G106600 chr4A 94.528 530 28 1 1709 2237 479980660 479980131 0.000000e+00 817.0
35 TraesCS5A01G106600 chr4A 93.985 532 28 3 1709 2237 435591062 435590532 0.000000e+00 802.0
36 TraesCS5A01G106600 chr4A 94.297 526 26 4 1709 2232 463753760 463754283 0.000000e+00 802.0
37 TraesCS5A01G106600 chr4A 90.730 356 27 6 1362 1714 213394215 213394567 9.350000e-129 470.0
38 TraesCS5A01G106600 chr4A 92.891 211 9 3 1 211 372644829 372645033 3.610000e-78 302.0
39 TraesCS5A01G106600 chr4A 93.605 172 9 2 254 424 433255206 433255036 2.850000e-64 255.0
40 TraesCS5A01G106600 chr4A 91.279 172 13 2 254 424 433246947 433246777 1.340000e-57 233.0
41 TraesCS5A01G106600 chr4A 80.543 221 31 9 46 264 94814674 94814464 2.300000e-35 159.0
42 TraesCS5A01G106600 chr4A 91.860 86 4 2 181 264 94776567 94776483 1.400000e-22 117.0
43 TraesCS5A01G106600 chr3A 94.518 529 28 1 1710 2237 659169254 659169782 0.000000e+00 815.0
44 TraesCS5A01G106600 chr3A 93.851 309 17 2 962 1269 446987497 446987190 4.350000e-127 464.0
45 TraesCS5A01G106600 chr3A 90.541 222 11 8 1 219 449978460 449978246 3.640000e-73 285.0
46 TraesCS5A01G106600 chr3A 88.889 162 18 0 1201 1362 378440984 378440823 1.350000e-47 200.0
47 TraesCS5A01G106600 chr1A 88.172 372 29 3 714 1071 177204791 177204421 1.590000e-116 429.0
48 TraesCS5A01G106600 chr1A 83.186 113 16 3 522 633 224844358 224844468 1.410000e-17 100.0
49 TraesCS5A01G106600 chr6D 89.524 105 9 2 522 625 251074055 251073952 5.010000e-27 132.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G106600 chr5A 176768565 176770801 2236 True 4132 4132 100.000 1 2237 1 chr5A.!!$R2 2236
1 TraesCS5A01G106600 chr5A 176765724 176767460 1736 False 2567 2567 93.506 1 1722 1 chr5A.!!$F1 1721
2 TraesCS5A01G106600 chr5A 343679456 343679984 528 True 804 804 94.140 1710 2237 1 chr5A.!!$R4 527
3 TraesCS5A01G106600 chr6A 394314461 394316191 1730 False 2540 2540 93.260 1 1722 1 chr6A.!!$F5 1721
4 TraesCS5A01G106600 chr6A 394306433 394308164 1731 False 2431 2431 92.122 1 1722 1 chr6A.!!$F4 1721
5 TraesCS5A01G106600 chr6A 256230862 256231389 527 False 798 798 93.951 1710 2237 1 chr6A.!!$F3 527
6 TraesCS5A01G106600 chr7A 198236865 198237691 826 False 1155 1155 92.140 715 1528 1 chr7A.!!$F1 813
7 TraesCS5A01G106600 chr7A 198244729 198245555 826 False 1127 1127 91.536 715 1528 1 chr7A.!!$F2 813
8 TraesCS5A01G106600 chr7A 273564616 273565148 532 False 809 809 94.184 1709 2237 1 chr7A.!!$F3 528
9 TraesCS5A01G106600 chr2A 257026137 257026913 776 True 968 968 89.460 608 1371 1 chr2A.!!$R1 763
10 TraesCS5A01G106600 chr2A 260045332 260045861 529 False 817 817 94.528 1709 2237 1 chr2A.!!$F2 528
11 TraesCS5A01G106600 chr4A 294131667 294132196 529 False 817 817 94.528 1709 2237 1 chr4A.!!$F2 528
12 TraesCS5A01G106600 chr4A 479980131 479980660 529 True 817 817 94.528 1709 2237 1 chr4A.!!$R6 528
13 TraesCS5A01G106600 chr4A 435590532 435591062 530 True 802 802 93.985 1709 2237 1 chr4A.!!$R5 528
14 TraesCS5A01G106600 chr4A 463753760 463754283 523 False 802 802 94.297 1709 2232 1 chr4A.!!$F4 523
15 TraesCS5A01G106600 chr3A 659169254 659169782 528 False 815 815 94.518 1710 2237 1 chr3A.!!$F1 527

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
256 259 0.676151 CTCTTGGGCCTCAGTTCAGC 60.676 60.0 4.53 0.0 0.0 4.26 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1633 1654 0.170561 CGGTCGTGGAAGTAGAGGTG 59.829 60.0 0.0 0.0 0.0 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 42 2.520069 TCCAAACGGTGCCAAATGTAT 58.480 42.857 0.00 0.00 0.00 2.29
42 43 2.894126 TCCAAACGGTGCCAAATGTATT 59.106 40.909 0.00 0.00 0.00 1.89
89 90 9.912634 CTTTTTATGAGTCTAAGAAAATTGGCA 57.087 29.630 0.00 0.00 0.00 4.92
256 259 0.676151 CTCTTGGGCCTCAGTTCAGC 60.676 60.000 4.53 0.00 0.00 4.26
466 473 3.385384 CCCTCACCTCTCAGCGCA 61.385 66.667 11.47 0.00 0.00 6.09
678 685 4.652131 AAACGCCGCCCCATGACA 62.652 61.111 0.00 0.00 0.00 3.58
753 761 2.981977 TTCGCCCGTCGTCTTGCTTT 62.982 55.000 0.00 0.00 39.67 3.51
871 879 4.287781 TCGAACACGCCGGCTTCA 62.288 61.111 26.68 9.53 0.00 3.02
895 903 1.532921 CGTTCCACGCATTGTTGTTGT 60.533 47.619 0.00 0.00 33.65 3.32
898 906 1.474478 TCCACGCATTGTTGTTGTTGT 59.526 42.857 0.00 0.00 0.00 3.32
1178 1199 2.920724 TTCATCAAGTTCCCACGACA 57.079 45.000 0.00 0.00 0.00 4.35
1194 1215 4.374399 CACGACAACTTAAGTGTACCCTT 58.626 43.478 9.34 0.00 0.00 3.95
1228 1249 0.601841 CCACTACCGTCGCCAAAACT 60.602 55.000 0.00 0.00 0.00 2.66
1229 1250 1.223187 CACTACCGTCGCCAAAACTT 58.777 50.000 0.00 0.00 0.00 2.66
1234 1255 1.156736 CCGTCGCCAAAACTTGAGAT 58.843 50.000 0.00 0.00 0.00 2.75
1247 1268 3.375699 ACTTGAGATGAAGTACCCCGAT 58.624 45.455 0.00 0.00 34.29 4.18
1302 1323 3.383505 CCTGGATATCGTCAAGTACCACA 59.616 47.826 0.00 0.00 0.00 4.17
1315 1336 1.039068 TACCACAACGACCCTCGAAA 58.961 50.000 0.00 0.00 43.74 3.46
1321 1342 1.529865 CAACGACCCTCGAAAAGTTCC 59.470 52.381 0.00 0.00 43.74 3.62
1389 1410 0.236187 CCGCCGTGATTTTCGACAAA 59.764 50.000 0.00 0.00 0.00 2.83
1467 1488 3.688673 ACTACTACTTCCACTACGACTGC 59.311 47.826 0.00 0.00 0.00 4.40
1566 1587 1.067142 ACTACACGATGTGACGCCAAT 60.067 47.619 3.61 0.00 36.96 3.16
1633 1654 0.241481 ACTTCCTCTTCGACTCGTGC 59.759 55.000 0.00 0.00 0.00 5.34
1648 1669 0.732880 CGTGCACCTCTACTTCCACG 60.733 60.000 12.15 0.00 39.75 4.94
1884 1906 5.970317 TGAGACATCCTACGAGTAAAACA 57.030 39.130 0.00 0.00 0.00 2.83
1946 1968 4.884668 TTTCGGACCAACACTTAGAGAT 57.115 40.909 0.00 0.00 0.00 2.75
1951 1973 2.668457 GACCAACACTTAGAGATGCACG 59.332 50.000 0.00 0.00 0.00 5.34
2029 2054 5.240844 AGGTGATAGGTTGTTAGTGCAAAAC 59.759 40.000 6.30 6.30 0.00 2.43
2074 2099 4.335416 CTGGAGGAGTTTTATTCAAGGCA 58.665 43.478 0.00 0.00 0.00 4.75
2131 2157 4.871933 AAGGAACGCAAAATCAAGGAAT 57.128 36.364 0.00 0.00 0.00 3.01
2214 2240 1.285078 GAGCCTTCCACCCTTTACCAT 59.715 52.381 0.00 0.00 0.00 3.55
2215 2241 1.285078 AGCCTTCCACCCTTTACCATC 59.715 52.381 0.00 0.00 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
14 15 0.526211 GGCACCGTTTGGAAGGATTC 59.474 55.000 0.00 0.00 46.67 2.52
89 90 2.646798 AGGAGAAGAATTTGAGCAGGGT 59.353 45.455 0.00 0.00 0.00 4.34
181 184 3.149196 CTGGACTATGCTCTCTCTCTCC 58.851 54.545 0.00 0.00 0.00 3.71
264 267 3.930035 CTTAGGGAGGATAGTGGGAAGT 58.070 50.000 0.00 0.00 0.00 3.01
466 473 3.226784 AGGATCCCCCTCCTGGTT 58.773 61.111 8.55 0.00 43.31 3.67
483 490 0.327924 GTGTGTGGTCATGGGGATCA 59.672 55.000 0.00 0.00 33.09 2.92
605 612 3.062466 CCTGGAGACGCGAGGACA 61.062 66.667 15.93 5.57 44.66 4.02
753 761 1.305633 CTGGTCCTCTCCTCCAGCA 60.306 63.158 0.00 0.00 41.46 4.41
895 903 0.895100 GGTGAGCTCATGGCCAACAA 60.895 55.000 21.47 0.00 43.05 2.83
898 906 1.203441 AGAGGTGAGCTCATGGCCAA 61.203 55.000 21.47 0.00 43.05 4.52
1194 1215 1.079405 GTGGAACTTGGCGATCCGA 60.079 57.895 0.00 0.00 37.39 4.55
1228 1249 2.434336 CCATCGGGGTACTTCATCTCAA 59.566 50.000 0.00 0.00 0.00 3.02
1229 1250 2.039418 CCATCGGGGTACTTCATCTCA 58.961 52.381 0.00 0.00 0.00 3.27
1247 1268 4.047059 GCCGGTCTCGACGAACCA 62.047 66.667 21.18 0.00 39.00 3.67
1302 1323 1.870993 CGGAACTTTTCGAGGGTCGTT 60.871 52.381 0.00 0.00 41.35 3.85
1315 1336 4.025145 GTCGAACTTGTTGAATCGGAACTT 60.025 41.667 0.00 0.00 36.05 2.66
1321 1342 4.862574 TCCATAGTCGAACTTGTTGAATCG 59.137 41.667 0.00 0.00 36.67 3.34
1389 1410 0.672342 AAGTAGAGGCACACGACGTT 59.328 50.000 0.00 0.00 29.38 3.99
1633 1654 0.170561 CGGTCGTGGAAGTAGAGGTG 59.829 60.000 0.00 0.00 0.00 4.00
1884 1906 0.848053 TCGGGGAAACTTGAGGGTTT 59.152 50.000 0.00 0.00 41.40 3.27
1979 2004 0.687354 GGGTTCTGCAGACTCAAGGA 59.313 55.000 18.03 0.00 0.00 3.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.