Multiple sequence alignment - TraesCS5A01G104300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G104300 chr5A 100.000 2500 0 0 1 2500 168400070 168397571 0 4617
1 TraesCS5A01G104300 chr5A 95.032 1409 39 15 604 1981 572301287 572302695 0 2185
2 TraesCS5A01G104300 chr5A 94.046 823 41 5 1166 1981 345671436 345670615 0 1242
3 TraesCS5A01G104300 chr2A 96.721 2531 51 14 1 2500 655909659 655907130 0 4185
4 TraesCS5A01G104300 chr2A 95.720 1402 33 15 604 1981 774011847 774010449 0 2231
5 TraesCS5A01G104300 chr1A 95.884 2527 73 16 1 2497 443853549 443856074 0 4061
6 TraesCS5A01G104300 chr1A 95.532 2126 58 8 406 2497 497975696 497977818 0 3365
7 TraesCS5A01G104300 chr1A 92.577 1401 76 18 1 1381 575419207 575420599 0 1986
8 TraesCS5A01G104300 chr1A 96.947 524 15 1 1974 2497 443857535 443858057 0 878
9 TraesCS5A01G104300 chr7A 95.499 2555 55 20 1 2500 644066567 644064018 0 4026
10 TraesCS5A01G104300 chr7A 97.683 1985 41 3 1 1981 49622982 49620999 0 3406
11 TraesCS5A01G104300 chr7A 96.185 1861 52 13 1 1853 633712364 633710515 0 3025
12 TraesCS5A01G104300 chr7A 94.748 1409 42 16 604 1981 1550089 1548682 0 2163
13 TraesCS5A01G104300 chr7A 94.929 1400 38 18 614 1981 579482645 579481247 0 2161
14 TraesCS5A01G104300 chr7A 95.074 1279 32 16 604 1851 481750009 481748731 0 1984
15 TraesCS5A01G104300 chr7A 93.925 823 42 5 1166 1981 578431317 578430496 0 1236
16 TraesCS5A01G104300 chr7A 97.137 524 15 0 1977 2500 633708827 633708304 0 885
17 TraesCS5A01G104300 chr7A 96.756 524 17 0 1977 2500 49620848 49620325 0 874
18 TraesCS5A01G104300 chr3A 92.924 1399 75 15 1 1381 513295156 513296548 0 2013
19 TraesCS5A01G104300 chr6A 92.664 1404 80 14 1 1386 401364634 401366032 0 2001
20 TraesCS5A01G104300 chr6A 94.878 820 29 9 1166 1981 436392242 436393052 0 1269
21 TraesCS5A01G104300 chr4A 95.414 1243 50 6 1 1240 429488330 429489568 0 1973
22 TraesCS5A01G104300 chr2B 91.207 1251 89 10 624 1853 103775473 103774223 0 1681
23 TraesCS5A01G104300 chr6B 97.115 520 15 0 1977 2496 180277292 180276773 0 878
24 TraesCS5A01G104300 chr3B 96.756 524 17 0 1977 2500 62765236 62764713 0 874


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G104300 chr5A 168397571 168400070 2499 True 4617.0 4617 100.0000 1 2500 1 chr5A.!!$R1 2499
1 TraesCS5A01G104300 chr5A 572301287 572302695 1408 False 2185.0 2185 95.0320 604 1981 1 chr5A.!!$F1 1377
2 TraesCS5A01G104300 chr5A 345670615 345671436 821 True 1242.0 1242 94.0460 1166 1981 1 chr5A.!!$R2 815
3 TraesCS5A01G104300 chr2A 655907130 655909659 2529 True 4185.0 4185 96.7210 1 2500 1 chr2A.!!$R1 2499
4 TraesCS5A01G104300 chr2A 774010449 774011847 1398 True 2231.0 2231 95.7200 604 1981 1 chr2A.!!$R2 1377
5 TraesCS5A01G104300 chr1A 497975696 497977818 2122 False 3365.0 3365 95.5320 406 2497 1 chr1A.!!$F1 2091
6 TraesCS5A01G104300 chr1A 443853549 443858057 4508 False 2469.5 4061 96.4155 1 2497 2 chr1A.!!$F3 2496
7 TraesCS5A01G104300 chr1A 575419207 575420599 1392 False 1986.0 1986 92.5770 1 1381 1 chr1A.!!$F2 1380
8 TraesCS5A01G104300 chr7A 644064018 644066567 2549 True 4026.0 4026 95.4990 1 2500 1 chr7A.!!$R5 2499
9 TraesCS5A01G104300 chr7A 1548682 1550089 1407 True 2163.0 2163 94.7480 604 1981 1 chr7A.!!$R1 1377
10 TraesCS5A01G104300 chr7A 579481247 579482645 1398 True 2161.0 2161 94.9290 614 1981 1 chr7A.!!$R4 1367
11 TraesCS5A01G104300 chr7A 49620325 49622982 2657 True 2140.0 3406 97.2195 1 2500 2 chr7A.!!$R6 2499
12 TraesCS5A01G104300 chr7A 481748731 481750009 1278 True 1984.0 1984 95.0740 604 1851 1 chr7A.!!$R2 1247
13 TraesCS5A01G104300 chr7A 633708304 633712364 4060 True 1955.0 3025 96.6610 1 2500 2 chr7A.!!$R7 2499
14 TraesCS5A01G104300 chr7A 578430496 578431317 821 True 1236.0 1236 93.9250 1166 1981 1 chr7A.!!$R3 815
15 TraesCS5A01G104300 chr3A 513295156 513296548 1392 False 2013.0 2013 92.9240 1 1381 1 chr3A.!!$F1 1380
16 TraesCS5A01G104300 chr6A 401364634 401366032 1398 False 2001.0 2001 92.6640 1 1386 1 chr6A.!!$F1 1385
17 TraesCS5A01G104300 chr6A 436392242 436393052 810 False 1269.0 1269 94.8780 1166 1981 1 chr6A.!!$F2 815
18 TraesCS5A01G104300 chr4A 429488330 429489568 1238 False 1973.0 1973 95.4140 1 1240 1 chr4A.!!$F1 1239
19 TraesCS5A01G104300 chr2B 103774223 103775473 1250 True 1681.0 1681 91.2070 624 1853 1 chr2B.!!$R1 1229
20 TraesCS5A01G104300 chr6B 180276773 180277292 519 True 878.0 878 97.1150 1977 2496 1 chr6B.!!$R1 519
21 TraesCS5A01G104300 chr3B 62764713 62765236 523 True 874.0 874 96.7560 1977 2500 1 chr3B.!!$R1 523

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
929 935 2.027434 ATGTACCTAGGGCCCGGCTA 62.027 60.0 18.44 1.91 0.0 3.93 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2033 3392 0.106819 GGGAGTAGCTACGAGGGTCA 60.107 60.0 17.99 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
188 189 4.142622 GCCAATAGCTTTCATGCGCATATA 60.143 41.667 24.84 11.78 38.99 0.86
222 223 6.431198 AAGTTGTTCAGTTTTGTACACGAT 57.569 33.333 0.00 0.00 34.81 3.73
929 935 2.027434 ATGTACCTAGGGCCCGGCTA 62.027 60.000 18.44 1.91 0.00 3.93
1205 1211 2.515071 GGAGCAGAGCGGGGATGAT 61.515 63.158 0.00 0.00 0.00 2.45
1311 1413 2.643551 CTATGTTGGTGGTGGATGACC 58.356 52.381 0.00 0.00 46.37 4.02
1359 1542 3.295304 CTCACGATGGTGGTGGCGA 62.295 63.158 8.09 0.00 44.50 5.54
1400 1610 3.372730 GCGCCTGCAATCCCACAA 61.373 61.111 0.00 0.00 42.15 3.33
1754 1980 9.121517 GCATGCTCATGTATGAAACAATATAAC 57.878 33.333 11.37 0.00 42.70 1.89
2033 3392 2.070783 CGCCAAAAAGCATGCATTTCT 58.929 42.857 20.12 8.84 0.00 2.52
2080 4100 1.376812 GACCACCTTCGGCCGATTT 60.377 57.895 31.56 13.59 0.00 2.17
2083 4103 0.107848 CCACCTTCGGCCGATTTAGT 60.108 55.000 31.56 20.29 0.00 2.24
2109 5453 0.597568 CGGCTGGAATTTGAACTGCA 59.402 50.000 0.00 0.00 0.00 4.41
2132 5476 0.394352 CCTCCATAGCTTGCCCGTTT 60.394 55.000 0.00 0.00 0.00 3.60
2201 5545 4.456911 ACAGAATCGACAACAGATTTGCAT 59.543 37.500 0.00 0.00 38.32 3.96
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
7 8 0.459899 CTCCAGTGTGCCGCTACATA 59.540 55.000 0.00 0.0 32.43 2.29
11 12 3.300934 CTGCTCCAGTGTGCCGCTA 62.301 63.158 3.42 0.0 0.00 4.26
188 189 8.548721 CAAAACTGAACAACTTTATAGTCGTCT 58.451 33.333 0.00 0.0 31.99 4.18
219 220 3.869065 ACACACCTACCCAATACAATCG 58.131 45.455 0.00 0.0 0.00 3.34
222 223 8.361139 CAATTTAAACACACCTACCCAATACAA 58.639 33.333 0.00 0.0 0.00 2.41
479 482 8.224025 TGGATATTTATGATAGCAAAAGTGGGA 58.776 33.333 0.00 0.0 0.00 4.37
706 710 8.819015 CAGAGTGATGATAAAGAAATGAGTGAG 58.181 37.037 0.00 0.0 0.00 3.51
789 795 2.325583 TCTTCGCAAACTTGTCAGGT 57.674 45.000 0.00 0.0 0.00 4.00
996 1002 0.605319 TCTTCACGGTGAACATGGCC 60.605 55.000 19.07 0.0 32.21 5.36
1205 1211 2.659016 CCGCTCTGCTCCTTGTCA 59.341 61.111 0.00 0.0 0.00 3.58
1251 1353 2.945008 CCACCATAGCATGTTCGTCATT 59.055 45.455 0.00 0.0 34.09 2.57
1317 1419 2.717044 CGTCCGCCACCACCATAGA 61.717 63.158 0.00 0.0 0.00 1.98
1400 1610 1.003355 CATGGTCCTGTCGCCAAGT 60.003 57.895 0.00 0.0 38.38 3.16
2033 3392 0.106819 GGGAGTAGCTACGAGGGTCA 60.107 60.000 17.99 0.0 0.00 4.02
2080 4100 0.988832 ATTCCAGCCGGTTCCAACTA 59.011 50.000 1.90 0.0 0.00 2.24
2083 4103 0.965439 CAAATTCCAGCCGGTTCCAA 59.035 50.000 1.90 0.0 0.00 3.53
2109 5453 1.348775 GGGCAAGCTATGGAGGACCT 61.349 60.000 0.00 0.0 37.04 3.85
2161 5505 0.918258 TGTGATGGAATGCCTGCCTA 59.082 50.000 0.00 0.0 34.31 3.93
2432 6438 1.538047 GGATGCGGCCATATCATTGT 58.462 50.000 15.76 0.0 0.00 2.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.