Multiple sequence alignment - TraesCS5A01G081300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G081300 chr5A 100.000 3880 0 0 1 3880 104247835 104251714 0.000000e+00 7166.0
1 TraesCS5A01G081300 chr7A 98.275 3884 51 8 1 3877 721762880 721766754 0.000000e+00 6787.0
2 TraesCS5A01G081300 chr7A 83.366 2549 306 53 1 2507 239566558 239564086 0.000000e+00 2250.0
3 TraesCS5A01G081300 chr6A 96.112 3909 110 14 1 3880 19279562 19275667 0.000000e+00 6338.0
4 TraesCS5A01G081300 chr6A 79.076 693 121 17 271 949 1892752 1892070 4.570000e-124 455.0
5 TraesCS5A01G081300 chr6A 87.903 124 10 3 3725 3847 9581596 9581715 1.450000e-29 141.0
6 TraesCS5A01G081300 chr2A 94.685 3895 126 22 44 3880 745565672 745561801 0.000000e+00 5971.0
7 TraesCS5A01G081300 chr1D 92.531 3923 171 37 2 3880 460731137 460727293 0.000000e+00 5509.0
8 TraesCS5A01G081300 chr6D 92.313 2875 122 29 1035 3880 466534316 466537120 0.000000e+00 3993.0
9 TraesCS5A01G081300 chr6D 92.477 771 43 3 1 756 466533544 466534314 0.000000e+00 1088.0
10 TraesCS5A01G081300 chr6D 78.467 613 107 16 280 877 2893826 2893224 1.020000e-100 377.0
11 TraesCS5A01G081300 chr6D 81.967 122 17 5 1496 1614 466534918 466535037 8.870000e-17 99.0
12 TraesCS5A01G081300 chr7D 90.546 1576 76 23 2330 3880 394265125 394266652 0.000000e+00 2017.0
13 TraesCS5A01G081300 chr4B 93.610 1205 46 11 2583 3764 16791572 16792768 0.000000e+00 1770.0
14 TraesCS5A01G081300 chr4B 96.429 84 2 1 3798 3880 16792766 16792849 1.880000e-28 137.0
15 TraesCS5A01G081300 chr7B 84.720 1610 199 17 1876 3455 727899244 727897652 0.000000e+00 1567.0
16 TraesCS5A01G081300 chr7B 84.792 1611 187 27 1876 3455 727926039 727924456 0.000000e+00 1565.0
17 TraesCS5A01G081300 chr7B 84.085 710 87 13 1182 1882 727946237 727945545 0.000000e+00 662.0
18 TraesCS5A01G081300 chr7B 86.572 633 32 24 3223 3850 706495114 706494530 0.000000e+00 649.0
19 TraesCS5A01G081300 chr7B 85.806 310 30 6 41 338 727946649 727946956 2.250000e-82 316.0
20 TraesCS5A01G081300 chr7B 87.273 220 21 4 1182 1398 727947216 727947431 1.080000e-60 244.0
21 TraesCS5A01G081300 chr7B 83.197 244 27 6 298 536 727946488 727946254 1.090000e-50 211.0
22 TraesCS5A01G081300 chr7B 91.026 156 11 1 3725 3880 727897221 727897069 1.410000e-49 207.0
23 TraesCS5A01G081300 chr7B 90.446 157 14 1 183 338 727946643 727946487 5.080000e-49 206.0
24 TraesCS5A01G081300 chr7B 88.462 156 15 1 3725 3880 727924027 727923875 6.620000e-43 185.0
25 TraesCS5A01G081300 chr7B 84.694 98 13 2 1518 1614 727945746 727945650 3.190000e-16 97.1
26 TraesCS5A01G081300 chr3B 88.640 1118 59 26 2755 3850 393320097 393321168 0.000000e+00 1299.0
27 TraesCS5A01G081300 chr2B 88.981 481 21 12 3287 3763 11369466 11369918 2.020000e-157 566.0
28 TraesCS5A01G081300 chr6B 82.031 256 30 8 1685 1935 617093069 617092825 1.830000e-48 204.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G081300 chr5A 104247835 104251714 3879 False 7166.000000 7166 100.0000 1 3880 1 chr5A.!!$F1 3879
1 TraesCS5A01G081300 chr7A 721762880 721766754 3874 False 6787.000000 6787 98.2750 1 3877 1 chr7A.!!$F1 3876
2 TraesCS5A01G081300 chr7A 239564086 239566558 2472 True 2250.000000 2250 83.3660 1 2507 1 chr7A.!!$R1 2506
3 TraesCS5A01G081300 chr6A 19275667 19279562 3895 True 6338.000000 6338 96.1120 1 3880 1 chr6A.!!$R2 3879
4 TraesCS5A01G081300 chr6A 1892070 1892752 682 True 455.000000 455 79.0760 271 949 1 chr6A.!!$R1 678
5 TraesCS5A01G081300 chr2A 745561801 745565672 3871 True 5971.000000 5971 94.6850 44 3880 1 chr2A.!!$R1 3836
6 TraesCS5A01G081300 chr1D 460727293 460731137 3844 True 5509.000000 5509 92.5310 2 3880 1 chr1D.!!$R1 3878
7 TraesCS5A01G081300 chr6D 466533544 466537120 3576 False 1726.666667 3993 88.9190 1 3880 3 chr6D.!!$F1 3879
8 TraesCS5A01G081300 chr6D 2893224 2893826 602 True 377.000000 377 78.4670 280 877 1 chr6D.!!$R1 597
9 TraesCS5A01G081300 chr7D 394265125 394266652 1527 False 2017.000000 2017 90.5460 2330 3880 1 chr7D.!!$F1 1550
10 TraesCS5A01G081300 chr4B 16791572 16792849 1277 False 953.500000 1770 95.0195 2583 3880 2 chr4B.!!$F1 1297
11 TraesCS5A01G081300 chr7B 727897069 727899244 2175 True 887.000000 1567 87.8730 1876 3880 2 chr7B.!!$R2 2004
12 TraesCS5A01G081300 chr7B 727923875 727926039 2164 True 875.000000 1565 86.6270 1876 3880 2 chr7B.!!$R3 2004
13 TraesCS5A01G081300 chr7B 706494530 706495114 584 True 649.000000 649 86.5720 3223 3850 1 chr7B.!!$R1 627
14 TraesCS5A01G081300 chr7B 727945545 727946643 1098 True 294.025000 662 85.6055 183 1882 4 chr7B.!!$R4 1699
15 TraesCS5A01G081300 chr7B 727946649 727947431 782 False 280.000000 316 86.5395 41 1398 2 chr7B.!!$F1 1357
16 TraesCS5A01G081300 chr3B 393320097 393321168 1071 False 1299.000000 1299 88.6400 2755 3850 1 chr3B.!!$F1 1095

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
39 40 6.551227 ACTTATGGCTTGATTTAAAGGATCCC 59.449 38.462 8.55 0.0 0.0 3.85 F
1256 1338 1.385743 CGTGCGAACTAGAAAACCTCG 59.614 52.381 0.00 0.0 0.0 4.63 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1417 1503 1.231928 GGGGGTCCACAGGTGTTTT 59.768 57.895 0.00 0.0 0.00 2.43 R
3028 3162 0.667453 TTGATCAACGCAGCAGCAAA 59.333 45.000 3.38 0.0 42.27 3.68 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
39 40 6.551227 ACTTATGGCTTGATTTAAAGGATCCC 59.449 38.462 8.55 0.00 0.00 3.85
1256 1338 1.385743 CGTGCGAACTAGAAAACCTCG 59.614 52.381 0.00 0.00 0.00 4.63
1417 1503 6.833041 TGTCCATCTGTACAGAAGGTAAAAA 58.167 36.000 34.57 19.81 44.37 1.94
1639 1730 3.850173 ACATATGTACACCCCCAGAAGTT 59.150 43.478 6.56 0.00 0.00 2.66
2431 2533 2.164219 CGGCAAATCAGGCACTAAATGT 59.836 45.455 0.00 0.00 36.02 2.71
3028 3162 6.014242 TGACATAAGACAGTTCAGAAGATGGT 60.014 38.462 1.35 0.00 0.00 3.55
3207 3345 6.095021 CACTATAGTTGTGTGGTGCTAGACTA 59.905 42.308 1.56 0.00 0.00 2.59
3629 3865 2.239402 TGATAGGCAAATGCTGTCCTGA 59.761 45.455 5.25 0.00 41.70 3.86
3800 4101 2.286872 GACCATGACTGAATCAGCTGG 58.713 52.381 15.13 19.31 41.91 4.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
39 40 6.539649 TTCAAGGTCAGTTTGTTATCTTCG 57.460 37.500 0.00 0.0 0.00 3.79
466 535 7.605691 ACTCAGAATTTCTCATAGAACCAAGTG 59.394 37.037 0.00 0.0 33.26 3.16
907 985 5.975988 ATTGCTTTTATCTCTCCCACCTA 57.024 39.130 0.00 0.0 0.00 3.08
983 1061 3.303001 GCGCATGCTGTTTTGCTTTTTAA 60.303 39.130 17.13 0.0 36.71 1.52
984 1062 2.220593 GCGCATGCTGTTTTGCTTTTTA 59.779 40.909 17.13 0.0 36.71 1.52
985 1063 1.003652 GCGCATGCTGTTTTGCTTTTT 60.004 42.857 17.13 0.0 36.71 1.94
987 1065 2.228115 GCGCATGCTGTTTTGCTTT 58.772 47.368 17.13 0.0 36.71 3.51
1256 1338 5.862924 TTGTACTAGCAGCAACATTCTTC 57.137 39.130 0.00 0.0 0.00 2.87
1417 1503 1.231928 GGGGGTCCACAGGTGTTTT 59.768 57.895 0.00 0.0 0.00 2.43
1639 1730 6.510879 TGCTATCGTCTCTTTCAGTCTTTA 57.489 37.500 0.00 0.0 0.00 1.85
2244 2346 9.615295 CGAGTACCTAAGAAAGAAGATATTAGC 57.385 37.037 0.00 0.0 0.00 3.09
2431 2533 4.962362 TCATGCTTCAGGTAGTTATCTCCA 59.038 41.667 0.00 0.0 0.00 3.86
2900 3023 4.679373 ATATTGCCGACAATCTCACTCT 57.321 40.909 0.00 0.0 43.08 3.24
3028 3162 0.667453 TTGATCAACGCAGCAGCAAA 59.333 45.000 3.38 0.0 42.27 3.68
3176 3314 3.055385 ACCACACAACTATAGTGCGGAAT 60.055 43.478 6.06 0.0 40.71 3.01
3207 3345 5.134509 CCCCAATCCTATTAACTCTTCCCTT 59.865 44.000 0.00 0.0 0.00 3.95
3629 3865 6.186957 TGGTAGGATGCACAAGTTGAAATAT 58.813 36.000 10.54 0.0 0.00 1.28
3800 4101 4.937620 TCCACATAGAGCATGTTTCAGTTC 59.062 41.667 0.00 0.0 46.01 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.