Multiple sequence alignment - TraesCS5A01G075800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G075800 chr5A 100.000 2549 0 0 1 2549 91048680 91051228 0.000000e+00 4708
1 TraesCS5A01G075800 chr5A 97.648 2551 53 4 1 2549 90997091 90999636 0.000000e+00 4372
2 TraesCS5A01G075800 chr5A 96.678 1987 60 5 568 2549 14186781 14184796 0.000000e+00 3299
3 TraesCS5A01G075800 chr5A 93.827 567 35 0 1 567 414559309 414558743 0.000000e+00 854
4 TraesCS5A01G075800 chr5A 93.474 567 37 0 1 567 414547714 414547148 0.000000e+00 843
5 TraesCS5A01G075800 chr7A 96.884 1990 50 7 566 2549 150203040 150201057 0.000000e+00 3321
6 TraesCS5A01G075800 chr7A 96.430 1989 57 8 568 2549 689996369 689994388 0.000000e+00 3267
7 TraesCS5A01G075800 chr7A 88.469 529 47 11 1 523 518314413 518313893 5.990000e-176 627
8 TraesCS5A01G075800 chr6A 96.200 2000 63 7 556 2549 200078188 200080180 0.000000e+00 3260
9 TraesCS5A01G075800 chr6A 96.233 1991 63 7 570 2549 484400741 484402730 0.000000e+00 3251
10 TraesCS5A01G075800 chr4A 96.127 1988 67 6 566 2549 626934248 626932267 0.000000e+00 3236
11 TraesCS5A01G075800 chr4A 95.088 570 24 2 1 567 362874160 362874728 0.000000e+00 894
12 TraesCS5A01G075800 chr4A 93.486 568 36 1 1 567 362881723 362882290 0.000000e+00 843
13 TraesCS5A01G075800 chr4A 87.896 537 52 13 1 533 503402192 503401665 1.000000e-173 619
14 TraesCS5A01G075800 chr6B 95.854 1978 71 8 563 2534 8435748 8437720 0.000000e+00 3188
15 TraesCS5A01G075800 chr6B 88.953 516 46 10 57 567 616913867 616914376 5.990000e-176 627
16 TraesCS5A01G075800 chr7B 95.585 1993 72 12 566 2549 552932145 552930160 0.000000e+00 3179
17 TraesCS5A01G075800 chr1A 88.469 529 49 12 1 523 143033901 143034423 1.660000e-176 628


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G075800 chr5A 91048680 91051228 2548 False 4708 4708 100.000 1 2549 1 chr5A.!!$F2 2548
1 TraesCS5A01G075800 chr5A 90997091 90999636 2545 False 4372 4372 97.648 1 2549 1 chr5A.!!$F1 2548
2 TraesCS5A01G075800 chr5A 14184796 14186781 1985 True 3299 3299 96.678 568 2549 1 chr5A.!!$R1 1981
3 TraesCS5A01G075800 chr5A 414558743 414559309 566 True 854 854 93.827 1 567 1 chr5A.!!$R3 566
4 TraesCS5A01G075800 chr5A 414547148 414547714 566 True 843 843 93.474 1 567 1 chr5A.!!$R2 566
5 TraesCS5A01G075800 chr7A 150201057 150203040 1983 True 3321 3321 96.884 566 2549 1 chr7A.!!$R1 1983
6 TraesCS5A01G075800 chr7A 689994388 689996369 1981 True 3267 3267 96.430 568 2549 1 chr7A.!!$R3 1981
7 TraesCS5A01G075800 chr7A 518313893 518314413 520 True 627 627 88.469 1 523 1 chr7A.!!$R2 522
8 TraesCS5A01G075800 chr6A 200078188 200080180 1992 False 3260 3260 96.200 556 2549 1 chr6A.!!$F1 1993
9 TraesCS5A01G075800 chr6A 484400741 484402730 1989 False 3251 3251 96.233 570 2549 1 chr6A.!!$F2 1979
10 TraesCS5A01G075800 chr4A 626932267 626934248 1981 True 3236 3236 96.127 566 2549 1 chr4A.!!$R2 1983
11 TraesCS5A01G075800 chr4A 362874160 362874728 568 False 894 894 95.088 1 567 1 chr4A.!!$F1 566
12 TraesCS5A01G075800 chr4A 362881723 362882290 567 False 843 843 93.486 1 567 1 chr4A.!!$F2 566
13 TraesCS5A01G075800 chr4A 503401665 503402192 527 True 619 619 87.896 1 533 1 chr4A.!!$R1 532
14 TraesCS5A01G075800 chr6B 8435748 8437720 1972 False 3188 3188 95.854 563 2534 1 chr6B.!!$F1 1971
15 TraesCS5A01G075800 chr6B 616913867 616914376 509 False 627 627 88.953 57 567 1 chr6B.!!$F2 510
16 TraesCS5A01G075800 chr7B 552930160 552932145 1985 True 3179 3179 95.585 566 2549 1 chr7B.!!$R1 1983
17 TraesCS5A01G075800 chr1A 143033901 143034423 522 False 628 628 88.469 1 523 1 chr1A.!!$F1 522

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
893 916 0.392193 GGCAGTGACCATGGTGAGAG 60.392 60.0 25.52 10.49 0.0 3.2 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1750 1790 2.380064 ATTTGTCCCAAGAGCAACCA 57.62 45.0 0.0 0.0 0.0 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
547 570 6.599244 CCACATGTCATACACAAAGGACTAAT 59.401 38.462 0.00 0.00 38.97 1.73
695 718 1.000163 GAACTCTGCCGTCTCTGTCAA 60.000 52.381 0.00 0.00 0.00 3.18
890 913 2.347114 CGGCAGTGACCATGGTGA 59.653 61.111 25.52 12.35 0.00 4.02
891 914 1.742880 CGGCAGTGACCATGGTGAG 60.743 63.158 25.52 10.06 0.00 3.51
892 915 1.679311 GGCAGTGACCATGGTGAGA 59.321 57.895 25.52 2.43 0.00 3.27
893 916 0.392193 GGCAGTGACCATGGTGAGAG 60.392 60.000 25.52 10.49 0.00 3.20
1013 1049 2.626840 GAGCTCCATGTCTTCCTCAAC 58.373 52.381 0.87 0.00 0.00 3.18
1021 1057 1.535444 TCTTCCTCAACCTCCCGCA 60.535 57.895 0.00 0.00 0.00 5.69
1022 1058 1.125093 TCTTCCTCAACCTCCCGCAA 61.125 55.000 0.00 0.00 0.00 4.85
1166 1202 0.546122 TGCAGCGAGAATGGGGTAAT 59.454 50.000 0.00 0.00 0.00 1.89
1172 1208 3.576982 AGCGAGAATGGGGTAATAATCGA 59.423 43.478 0.00 0.00 0.00 3.59
1190 1226 1.727880 CGAGGCAATTGCACCATTTTG 59.272 47.619 30.32 9.33 44.36 2.44
1258 1294 3.611057 GCAGGTGACATGCTTCTTTCTTG 60.611 47.826 15.63 0.00 40.59 3.02
1500 1536 6.696411 CAAATACTTTTGGGCATTTGTAGGA 58.304 36.000 0.00 0.00 38.85 2.94
1611 1649 8.715190 AACCACCTAGTTTAAATGTTGGTTAT 57.285 30.769 14.34 2.32 34.62 1.89
1743 1783 0.676151 CTGCTCTGCCTTTCTGTCCC 60.676 60.000 0.00 0.00 0.00 4.46
1867 1907 9.959749 TCTTGCGTATTTTTCTGTTTTCTATTT 57.040 25.926 0.00 0.00 0.00 1.40
2184 2227 2.203596 ACTCGAACCCAGGACCGT 60.204 61.111 0.00 0.00 0.00 4.83
2203 2246 2.163815 CGTGTGGGTTTGTGGTGTTTAA 59.836 45.455 0.00 0.00 0.00 1.52
2284 2327 8.085296 GGAAGGTATACATAGTGAGATTGTGAG 58.915 40.741 5.01 0.00 0.00 3.51
2326 2374 1.202234 CCGTGAATGTTTGCACACACA 60.202 47.619 8.06 0.00 35.03 3.72
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
890 913 1.831106 TCGTGCTCTCTCTCTCTCTCT 59.169 52.381 0.00 0.0 0.00 3.10
891 914 1.933853 GTCGTGCTCTCTCTCTCTCTC 59.066 57.143 0.00 0.0 0.00 3.20
892 915 1.739035 CGTCGTGCTCTCTCTCTCTCT 60.739 57.143 0.00 0.0 0.00 3.10
893 916 0.650512 CGTCGTGCTCTCTCTCTCTC 59.349 60.000 0.00 0.0 0.00 3.20
1166 1202 2.121291 TGGTGCAATTGCCTCGATTA 57.879 45.000 26.94 4.0 41.18 1.75
1172 1208 3.340034 CATCAAAATGGTGCAATTGCCT 58.660 40.909 26.94 7.0 41.18 4.75
1190 1226 1.134401 TGCTCAAAGATCCCGACCATC 60.134 52.381 0.00 0.0 0.00 3.51
1258 1294 4.554036 GGCCAGAGCATCGACCCC 62.554 72.222 0.00 0.0 42.67 4.95
1500 1536 2.436417 ACAAGCAGTGCGATTACCATT 58.564 42.857 10.00 0.0 0.00 3.16
1750 1790 2.380064 ATTTGTCCCAAGAGCAACCA 57.620 45.000 0.00 0.0 0.00 3.67
1764 1804 4.226427 TGGCTCTATGCTCTGAATTTGT 57.774 40.909 0.00 0.0 42.39 2.83
2184 2227 2.761208 CCTTAAACACCACAAACCCACA 59.239 45.455 0.00 0.0 0.00 4.17
2326 2374 6.282930 CAAAACAATGGAAAACCACTCTCAT 58.717 36.000 0.00 0.0 0.00 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.