Multiple sequence alignment - TraesCS5A01G068300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G068300 chr5A 100.000 2708 0 0 1 2708 76544282 76546989 0.000000e+00 5001
1 TraesCS5A01G068300 chr5A 99.188 2708 22 0 1 2708 76517520 76520227 0.000000e+00 4879
2 TraesCS5A01G068300 chr5A 99.141 2213 19 0 496 2708 76491584 76493796 0.000000e+00 3982
3 TraesCS5A01G068300 chr5A 98.059 2061 37 1 496 2556 75338948 75341005 0.000000e+00 3581
4 TraesCS5A01G068300 chr5A 91.153 633 40 8 1714 2331 75349344 75349975 0.000000e+00 845
5 TraesCS5A01G068300 chr5A 97.183 497 14 0 1 497 76720286 76720782 0.000000e+00 841
6 TraesCS5A01G068300 chr5A 93.913 115 7 0 2576 2690 75349233 75349347 9.970000e-40 174
7 TraesCS5A01G068300 chr5D 96.368 2065 63 5 496 2553 80300088 80302147 0.000000e+00 3387
8 TraesCS5A01G068300 chr5D 92.208 154 10 2 2555 2708 80303367 80303518 1.630000e-52 217
9 TraesCS5A01G068300 chr5B 95.461 1983 71 7 496 2465 88859511 88861487 0.000000e+00 3145
10 TraesCS5A01G068300 chr5B 94.667 150 8 0 2559 2708 88863785 88863934 1.620000e-57 233
11 TraesCS5A01G068300 chr5B 98.000 100 2 0 2457 2556 88862645 88862744 9.970000e-40 174
12 TraesCS5A01G068300 chr4A 96.378 497 18 0 1 497 446377308 446377804 0.000000e+00 819
13 TraesCS5A01G068300 chr3A 96.378 497 18 0 1 497 147125879 147126375 0.000000e+00 819
14 TraesCS5A01G068300 chr3A 96.177 497 19 0 1 497 523244707 523245203 0.000000e+00 813
15 TraesCS5A01G068300 chr6A 96.177 497 19 0 1 497 108035544 108035048 0.000000e+00 813
16 TraesCS5A01G068300 chr1A 96.177 497 19 0 1 497 552314730 552315226 0.000000e+00 813
17 TraesCS5A01G068300 chr1A 95.976 497 20 0 1 497 578685483 578685979 0.000000e+00 808
18 TraesCS5A01G068300 chr2A 96.169 496 19 0 1 496 86594965 86595460 0.000000e+00 811
19 TraesCS5A01G068300 chr2A 82.877 146 25 0 2561 2706 434957825 434957680 6.080000e-27 132
20 TraesCS5A01G068300 chr3B 83.007 153 26 0 2556 2708 207050511 207050663 3.640000e-29 139
21 TraesCS5A01G068300 chr2D 83.562 146 24 0 2561 2706 328459579 328459434 1.310000e-28 137


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G068300 chr5A 76544282 76546989 2707 False 5001.0 5001 100.000000 1 2708 1 chr5A.!!$F4 2707
1 TraesCS5A01G068300 chr5A 76517520 76520227 2707 False 4879.0 4879 99.188000 1 2708 1 chr5A.!!$F3 2707
2 TraesCS5A01G068300 chr5A 76491584 76493796 2212 False 3982.0 3982 99.141000 496 2708 1 chr5A.!!$F2 2212
3 TraesCS5A01G068300 chr5A 75338948 75341005 2057 False 3581.0 3581 98.059000 496 2556 1 chr5A.!!$F1 2060
4 TraesCS5A01G068300 chr5A 75349233 75349975 742 False 509.5 845 92.533000 1714 2690 2 chr5A.!!$F6 976
5 TraesCS5A01G068300 chr5D 80300088 80303518 3430 False 1802.0 3387 94.288000 496 2708 2 chr5D.!!$F1 2212
6 TraesCS5A01G068300 chr5B 88859511 88863934 4423 False 1184.0 3145 96.042667 496 2708 3 chr5B.!!$F1 2212

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
61 62 0.108138 GTATCTGGCACAAGCGGTCT 60.108 55.000 0.00 0.0 43.41 3.85 F
381 382 0.745845 GCAAGCCACTCGTCATGGAT 60.746 55.000 6.55 0.0 39.87 3.41 F
504 505 4.202357 TGGCTATTGAATTACGCTCTGGAT 60.202 41.667 0.00 0.0 0.00 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1252 1253 4.401022 TGAAGAAACATCACCTGAATGCT 58.599 39.130 0.00 0.00 0.00 3.79 R
1253 1254 4.771590 TGAAGAAACATCACCTGAATGC 57.228 40.909 0.00 0.00 0.00 3.56 R
2021 2023 6.378280 TCAGCATAGAGTTCAGTGATTCACTA 59.622 38.462 18.59 2.06 43.43 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
61 62 0.108138 GTATCTGGCACAAGCGGTCT 60.108 55.000 0.00 0.00 43.41 3.85
88 89 3.599602 TCCAAACTGGATGGGCCA 58.400 55.556 9.61 9.61 42.67 5.36
381 382 0.745845 GCAAGCCACTCGTCATGGAT 60.746 55.000 6.55 0.00 39.87 3.41
504 505 4.202357 TGGCTATTGAATTACGCTCTGGAT 60.202 41.667 0.00 0.00 0.00 3.41
1252 1253 0.756294 TCCGTGCTTGGAGAAGTTGA 59.244 50.000 0.00 0.00 33.05 3.18
1253 1254 1.151668 CCGTGCTTGGAGAAGTTGAG 58.848 55.000 0.00 0.00 0.00 3.02
1562 1563 7.175641 CAGGAATAACAATGAGAAGTTCTTGGT 59.824 37.037 6.88 2.78 0.00 3.67
2021 2023 7.023575 GCTGTTGAAGTTATCGTTTGATCAAT 58.976 34.615 9.40 0.00 35.99 2.57
2288 2304 1.197036 CAATAGCCGCTGCAGATCATG 59.803 52.381 20.43 2.40 41.13 3.07
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
56 57 4.976731 CAGTTTGGATCGAATACTAGACCG 59.023 45.833 0.00 0.00 0.00 4.79
82 83 3.075283 TCAAAAGAAATCCTAGTGGCCCA 59.925 43.478 0.00 0.00 0.00 5.36
88 89 7.544804 AAAGCCATTCAAAAGAAATCCTAGT 57.455 32.000 0.00 0.00 0.00 2.57
358 359 4.373116 GACGAGTGGCTTGCCCGA 62.373 66.667 13.87 0.00 35.87 5.14
381 382 2.205022 AGCAGCCTTCAAGCACAATA 57.795 45.000 0.00 0.00 34.23 1.90
504 505 5.241403 TGAAATCAAGCTCCTCAAGGTTA 57.759 39.130 0.00 0.00 43.77 2.85
1252 1253 4.401022 TGAAGAAACATCACCTGAATGCT 58.599 39.130 0.00 0.00 0.00 3.79
1253 1254 4.771590 TGAAGAAACATCACCTGAATGC 57.228 40.909 0.00 0.00 0.00 3.56
2021 2023 6.378280 TCAGCATAGAGTTCAGTGATTCACTA 59.622 38.462 18.59 2.06 43.43 2.74
2288 2304 9.606631 AGTATCTTCTGAAGGATACAACAAATC 57.393 33.333 24.94 9.69 43.74 2.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.