Multiple sequence alignment - TraesCS5A01G066100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G066100 chr5A 100.000 2843 0 0 1 2843 73031592 73034434 0 5251
1 TraesCS5A01G066100 chr7A 99.015 2843 23 3 1 2843 60106996 60104159 0 5090
2 TraesCS5A01G066100 chr7A 98.990 891 9 0 1953 2843 4936493 4935603 0 1596
3 TraesCS5A01G066100 chr1B 98.699 2845 34 2 1 2843 638750009 638747166 0 5046
4 TraesCS5A01G066100 chr2B 98.172 2844 50 2 1 2843 500714119 500716961 0 4963
5 TraesCS5A01G066100 chr2B 97.115 2842 79 3 1 2842 751970383 751967545 0 4791
6 TraesCS5A01G066100 chr2B 98.339 2348 35 3 497 2843 357761029 357758685 0 4117
7 TraesCS5A01G066100 chr6B 97.714 2843 63 1 1 2843 388367632 388364792 0 4889
8 TraesCS5A01G066100 chr6B 96.588 2843 87 6 1 2843 626863024 626865856 0 4704
9 TraesCS5A01G066100 chr6B 96.442 2333 81 1 1 2333 588838955 588841285 0 3847
10 TraesCS5A01G066100 chr3B 97.679 2843 65 1 1 2843 575754723 575751882 0 4883


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G066100 chr5A 73031592 73034434 2842 False 5251 5251 100.000 1 2843 1 chr5A.!!$F1 2842
1 TraesCS5A01G066100 chr7A 60104159 60106996 2837 True 5090 5090 99.015 1 2843 1 chr7A.!!$R2 2842
2 TraesCS5A01G066100 chr7A 4935603 4936493 890 True 1596 1596 98.990 1953 2843 1 chr7A.!!$R1 890
3 TraesCS5A01G066100 chr1B 638747166 638750009 2843 True 5046 5046 98.699 1 2843 1 chr1B.!!$R1 2842
4 TraesCS5A01G066100 chr2B 500714119 500716961 2842 False 4963 4963 98.172 1 2843 1 chr2B.!!$F1 2842
5 TraesCS5A01G066100 chr2B 751967545 751970383 2838 True 4791 4791 97.115 1 2842 1 chr2B.!!$R2 2841
6 TraesCS5A01G066100 chr2B 357758685 357761029 2344 True 4117 4117 98.339 497 2843 1 chr2B.!!$R1 2346
7 TraesCS5A01G066100 chr6B 388364792 388367632 2840 True 4889 4889 97.714 1 2843 1 chr6B.!!$R1 2842
8 TraesCS5A01G066100 chr6B 626863024 626865856 2832 False 4704 4704 96.588 1 2843 1 chr6B.!!$F2 2842
9 TraesCS5A01G066100 chr6B 588838955 588841285 2330 False 3847 3847 96.442 1 2333 1 chr6B.!!$F1 2332
10 TraesCS5A01G066100 chr3B 575751882 575754723 2841 True 4883 4883 97.679 1 2843 1 chr3B.!!$R1 2842

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
297 298 4.002906 TCAATGGCACGAGTAAGAAACT 57.997 40.909 0.00 0.00 42.8 2.66 F
1331 1332 6.598503 TCTTCATAGTCTCGGAGGTTATGTA 58.401 40.000 19.62 13.87 0.0 2.29 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1221 1222 0.035820 GTAGAACATCCCGCCACCAA 60.036 55.000 0.00 0.0 0.00 3.67 R
2716 2720 9.674068 GAGAAGTGGTTCCTTTTCTTTCTATAT 57.326 33.333 8.78 0.0 32.48 0.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
297 298 4.002906 TCAATGGCACGAGTAAGAAACT 57.997 40.909 0.00 0.00 42.80 2.66
1331 1332 6.598503 TCTTCATAGTCTCGGAGGTTATGTA 58.401 40.000 19.62 13.87 0.00 2.29
1979 1980 3.447586 CAGACCCAGGAAGAATACGAAGA 59.552 47.826 0.00 0.00 0.00 2.87
2128 2129 3.951680 TCGAGTTCAGTATGGATGCACTA 59.048 43.478 0.00 0.00 36.16 2.74
2291 2292 4.445710 TAGGGCCCGCTCGGTACA 62.446 66.667 18.44 0.00 0.00 2.90
2716 2720 9.791820 CATTCAATAAGTGCATCAAGTATTTCA 57.208 29.630 0.00 0.00 0.00 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 42 5.007034 TCTCATCTTTTGTATTGGCCGAAA 58.993 37.500 0.00 0.00 0.00 3.46
297 298 1.673626 GCGACCCGTGAAAATACCTCA 60.674 52.381 0.00 0.00 0.00 3.86
1221 1222 0.035820 GTAGAACATCCCGCCACCAA 60.036 55.000 0.00 0.00 0.00 3.67
1552 1553 4.965532 AGTGGATACTAGAGCCAGTGAAAT 59.034 41.667 0.00 0.00 46.85 2.17
1766 1767 2.632028 ACAAAATGCCAGTACCATGCAA 59.368 40.909 5.76 0.00 38.69 4.08
1979 1980 1.862602 GCGCGGTTGAGGAAATTGGT 61.863 55.000 8.83 0.00 0.00 3.67
2128 2129 1.014564 GCGAGTGGTCTTAAGCGCTT 61.015 55.000 27.97 27.97 43.47 4.68
2716 2720 9.674068 GAGAAGTGGTTCCTTTTCTTTCTATAT 57.326 33.333 8.78 0.00 32.48 0.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.