Multiple sequence alignment - TraesCS5A01G064100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G064100 chr5A 100.000 2445 0 0 1 2445 69535122 69537566 0.000000e+00 4516
1 TraesCS5A01G064100 chr5A 94.223 1783 67 10 674 2445 136568044 136569801 0.000000e+00 2689
2 TraesCS5A01G064100 chr3A 97.084 1783 40 2 674 2445 128659542 128657761 0.000000e+00 2994
3 TraesCS5A01G064100 chr2A 96.074 1783 42 3 674 2445 276858522 276860287 0.000000e+00 2880
4 TraesCS5A01G064100 chr2A 91.541 532 34 9 1 527 507199555 507200080 0.000000e+00 723
5 TraesCS5A01G064100 chr2A 83.308 665 91 18 6 659 661404227 661404882 1.620000e-166 595
6 TraesCS5A01G064100 chr4A 95.738 1783 64 2 674 2445 566589971 566588190 0.000000e+00 2861
7 TraesCS5A01G064100 chr4A 95.685 1738 63 2 674 2400 566610673 566608937 0.000000e+00 2784
8 TraesCS5A01G064100 chr4A 83.283 664 96 11 2 659 299483661 299484315 4.500000e-167 597
9 TraesCS5A01G064100 chr3B 92.925 1781 110 5 680 2444 367032838 367031058 0.000000e+00 2577
10 TraesCS5A01G064100 chr3B 92.536 1782 116 7 675 2442 379653362 379655140 0.000000e+00 2538
11 TraesCS5A01G064100 chr3B 82.973 693 87 23 1 674 769455062 769455742 4.500000e-167 597
12 TraesCS5A01G064100 chr3B 81.194 670 107 16 1 659 294284763 294284102 2.790000e-144 521
13 TraesCS5A01G064100 chr6B 92.609 1786 114 8 674 2445 129700732 129702513 0.000000e+00 2551
14 TraesCS5A01G064100 chr7B 91.877 1785 122 10 674 2445 722093996 722095770 0.000000e+00 2471
15 TraesCS5A01G064100 chr7B 81.113 683 105 21 6 670 489776240 489775564 2.150000e-145 525
16 TraesCS5A01G064100 chr6A 91.265 1786 126 6 674 2445 509827186 509825417 0.000000e+00 2407
17 TraesCS5A01G064100 chr5B 91.244 1793 112 10 674 2445 328273423 328275191 0.000000e+00 2399
18 TraesCS5A01G064100 chr1A 84.478 670 79 17 18 675 113219179 113219835 2.650000e-179 638
19 TraesCS5A01G064100 chr7D 83.010 671 94 15 18 675 619888583 619889246 7.530000e-165 590
20 TraesCS5A01G064100 chr7D 82.122 688 102 18 1 675 464357538 464356859 9.810000e-159 569
21 TraesCS5A01G064100 chr7A 83.033 666 93 19 6 659 605179281 605179938 9.740000e-164 586


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G064100 chr5A 69535122 69537566 2444 False 4516 4516 100.000 1 2445 1 chr5A.!!$F1 2444
1 TraesCS5A01G064100 chr5A 136568044 136569801 1757 False 2689 2689 94.223 674 2445 1 chr5A.!!$F2 1771
2 TraesCS5A01G064100 chr3A 128657761 128659542 1781 True 2994 2994 97.084 674 2445 1 chr3A.!!$R1 1771
3 TraesCS5A01G064100 chr2A 276858522 276860287 1765 False 2880 2880 96.074 674 2445 1 chr2A.!!$F1 1771
4 TraesCS5A01G064100 chr2A 507199555 507200080 525 False 723 723 91.541 1 527 1 chr2A.!!$F2 526
5 TraesCS5A01G064100 chr2A 661404227 661404882 655 False 595 595 83.308 6 659 1 chr2A.!!$F3 653
6 TraesCS5A01G064100 chr4A 566588190 566589971 1781 True 2861 2861 95.738 674 2445 1 chr4A.!!$R1 1771
7 TraesCS5A01G064100 chr4A 566608937 566610673 1736 True 2784 2784 95.685 674 2400 1 chr4A.!!$R2 1726
8 TraesCS5A01G064100 chr4A 299483661 299484315 654 False 597 597 83.283 2 659 1 chr4A.!!$F1 657
9 TraesCS5A01G064100 chr3B 367031058 367032838 1780 True 2577 2577 92.925 680 2444 1 chr3B.!!$R2 1764
10 TraesCS5A01G064100 chr3B 379653362 379655140 1778 False 2538 2538 92.536 675 2442 1 chr3B.!!$F1 1767
11 TraesCS5A01G064100 chr3B 769455062 769455742 680 False 597 597 82.973 1 674 1 chr3B.!!$F2 673
12 TraesCS5A01G064100 chr3B 294284102 294284763 661 True 521 521 81.194 1 659 1 chr3B.!!$R1 658
13 TraesCS5A01G064100 chr6B 129700732 129702513 1781 False 2551 2551 92.609 674 2445 1 chr6B.!!$F1 1771
14 TraesCS5A01G064100 chr7B 722093996 722095770 1774 False 2471 2471 91.877 674 2445 1 chr7B.!!$F1 1771
15 TraesCS5A01G064100 chr7B 489775564 489776240 676 True 525 525 81.113 6 670 1 chr7B.!!$R1 664
16 TraesCS5A01G064100 chr6A 509825417 509827186 1769 True 2407 2407 91.265 674 2445 1 chr6A.!!$R1 1771
17 TraesCS5A01G064100 chr5B 328273423 328275191 1768 False 2399 2399 91.244 674 2445 1 chr5B.!!$F1 1771
18 TraesCS5A01G064100 chr1A 113219179 113219835 656 False 638 638 84.478 18 675 1 chr1A.!!$F1 657
19 TraesCS5A01G064100 chr7D 619888583 619889246 663 False 590 590 83.010 18 675 1 chr7D.!!$F1 657
20 TraesCS5A01G064100 chr7D 464356859 464357538 679 True 569 569 82.122 1 675 1 chr7D.!!$R1 674
21 TraesCS5A01G064100 chr7A 605179281 605179938 657 False 586 586 83.033 6 659 1 chr7A.!!$F1 653

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
583 620 1.467342 GTCGCCCTGTGTGGAAAATAC 59.533 52.381 0.00 0.0 38.35 1.89 F
1225 1276 2.048597 CACGTGGTGAAGCGGCTA 60.049 61.111 7.95 0.0 35.23 3.93 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1399 1450 0.678684 TGAGTACGGGCACGAGATCA 60.679 55.000 19.19 12.99 44.6 2.92 R
2404 2480 3.954258 GCCCCAAATGTTGTAGCTTAGAT 59.046 43.478 0.00 0.00 0.0 1.98 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
296 313 8.902040 TGCACAATTTTGGAAAACAATAAAAC 57.098 26.923 0.00 0.00 39.21 2.43
540 577 3.827722 GGCTAGCCCATTATTGGTTGTA 58.172 45.455 24.19 0.00 41.91 2.41
551 588 2.319136 TTGGTTGTACTGTGCGAAGT 57.681 45.000 0.00 0.00 0.00 3.01
583 620 1.467342 GTCGCCCTGTGTGGAAAATAC 59.533 52.381 0.00 0.00 38.35 1.89
600 639 4.900635 AATACAATTTTCCTAGCTGCGG 57.099 40.909 0.00 0.00 0.00 5.69
1225 1276 2.048597 CACGTGGTGAAGCGGCTA 60.049 61.111 7.95 0.00 35.23 3.93
1399 1450 2.261671 GTCGTGCACATCTCCGGT 59.738 61.111 18.64 0.00 0.00 5.28
1402 1453 1.153568 CGTGCACATCTCCGGTGAT 60.154 57.895 18.64 13.23 38.54 3.06
1412 1463 4.873129 CCGGTGATCTCGTGCCCG 62.873 72.222 0.00 0.00 38.39 6.13
1741 1814 2.972348 TGAGTGAAGAGGGGTGTACTT 58.028 47.619 0.00 0.00 0.00 2.24
2248 2324 9.753674 TCATATAGGGTTTTCTTTCTGTTTGAT 57.246 29.630 0.00 0.00 0.00 2.57
2314 2390 8.847196 GTGTTATAGGGTTTTCTTTTGAACTCT 58.153 33.333 0.00 0.00 39.73 3.24
2404 2480 5.989168 ACACACGATAAACATTCTGAAGTCA 59.011 36.000 0.00 0.00 0.00 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
250 267 9.504708 TGTGCATGATTTCCAAAAAGAAAATAT 57.495 25.926 0.00 0.00 39.11 1.28
251 268 8.899427 TGTGCATGATTTCCAAAAAGAAAATA 57.101 26.923 0.00 0.00 39.11 1.40
540 577 0.956633 TAGTCGGAACTTCGCACAGT 59.043 50.000 0.00 0.00 36.92 3.55
583 620 0.740737 CCCCGCAGCTAGGAAAATTG 59.259 55.000 8.84 0.00 0.00 2.32
1047 1096 4.385405 GCCTGCTCGGACTGCTGT 62.385 66.667 0.00 0.00 33.16 4.40
1399 1450 0.678684 TGAGTACGGGCACGAGATCA 60.679 55.000 19.19 12.99 44.60 2.92
1402 1453 1.592400 CCTTGAGTACGGGCACGAGA 61.592 60.000 19.19 0.00 44.60 4.04
1412 1463 2.508663 GCCGGCGTCCTTGAGTAC 60.509 66.667 12.58 0.00 0.00 2.73
1490 1541 1.327507 GGTTGTTCGTACGTCCGTAC 58.672 55.000 16.05 17.62 45.29 3.67
1741 1814 9.461312 AGGAACATGATTTATACAGTGCTAAAA 57.539 29.630 0.00 0.00 0.00 1.52
2325 2401 8.491045 TCCTATCATCACATAAGTCCATGTAA 57.509 34.615 0.00 0.00 37.02 2.41
2404 2480 3.954258 GCCCCAAATGTTGTAGCTTAGAT 59.046 43.478 0.00 0.00 0.00 1.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.