Multiple sequence alignment - TraesCS5A01G062100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G062100 chr5A 100.000 2222 0 0 1 2222 66823326 66825547 0.000000e+00 4104
1 TraesCS5A01G062100 chr5A 94.585 868 39 3 679 1539 601069574 601070440 0.000000e+00 1336
2 TraesCS5A01G062100 chr5A 93.533 835 46 3 679 1506 689484581 689483748 0.000000e+00 1236
3 TraesCS5A01G062100 chr5A 93.139 685 20 4 1 681 1240582 1241243 0.000000e+00 979
4 TraesCS5A01G062100 chr1A 98.448 1546 16 3 1 1538 432523261 432524806 0.000000e+00 2715
5 TraesCS5A01G062100 chr1A 94.428 682 14 3 1 681 20992388 20991730 0.000000e+00 1027
6 TraesCS5A01G062100 chr6A 96.054 1546 30 5 1 1538 472969352 472970874 0.000000e+00 2488
7 TraesCS5A01G062100 chr6A 95.537 1546 37 6 1 1538 595511656 595510135 0.000000e+00 2444
8 TraesCS5A01G062100 chr6A 96.009 451 16 2 1756 2204 502544636 502544186 0.000000e+00 732
9 TraesCS5A01G062100 chr6A 93.651 126 2 3 1539 1662 502544770 502544649 1.360000e-42 183
10 TraesCS5A01G062100 chr7A 98.276 1102 19 0 1 1102 722569868 722570969 0.000000e+00 1930
11 TraesCS5A01G062100 chr7A 95.057 870 33 5 679 1539 677975067 677975935 0.000000e+00 1360
12 TraesCS5A01G062100 chr7A 93.541 867 48 3 679 1538 668555624 668554759 0.000000e+00 1284
13 TraesCS5A01G062100 chr7A 93.695 682 19 8 1 681 609346772 609347430 0.000000e+00 1000
14 TraesCS5A01G062100 chr7A 92.962 682 24 3 1 681 668556477 668555819 0.000000e+00 972
15 TraesCS5A01G062100 chr5B 95.046 868 35 3 679 1538 492816263 492815396 0.000000e+00 1358
16 TraesCS5A01G062100 chr4B 94.925 867 37 2 679 1538 604143656 604144522 0.000000e+00 1351
17 TraesCS5A01G062100 chr4B 89.972 359 12 3 1 358 564153928 564154263 2.020000e-120 442
18 TraesCS5A01G062100 chr4B 89.972 359 12 3 1 358 564154675 564155010 2.020000e-120 442
19 TraesCS5A01G062100 chr3A 94.585 868 38 4 679 1537 11598359 11597492 0.000000e+00 1334
20 TraesCS5A01G062100 chr3A 96.175 732 27 1 810 1540 27583272 27584003 0.000000e+00 1195
21 TraesCS5A01G062100 chr3A 93.548 682 20 3 1 681 11599212 11598554 0.000000e+00 994
22 TraesCS5A01G062100 chr4A 94.233 867 43 2 679 1538 553534728 553535594 0.000000e+00 1317
23 TraesCS5A01G062100 chr6D 97.089 687 12 3 1537 2222 361416401 361415722 0.000000e+00 1151
24 TraesCS5A01G062100 chr6B 96.821 692 12 4 1537 2222 543082739 543082052 0.000000e+00 1147
25 TraesCS5A01G062100 chr2B 93.558 683 19 4 1 681 721722974 721723633 0.000000e+00 994
26 TraesCS5A01G062100 chr7B 89.912 684 41 10 1 680 692795215 692795874 0.000000e+00 856


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G062100 chr5A 66823326 66825547 2221 False 4104.0 4104 100.0000 1 2222 1 chr5A.!!$F2 2221
1 TraesCS5A01G062100 chr5A 601069574 601070440 866 False 1336.0 1336 94.5850 679 1539 1 chr5A.!!$F3 860
2 TraesCS5A01G062100 chr5A 689483748 689484581 833 True 1236.0 1236 93.5330 679 1506 1 chr5A.!!$R1 827
3 TraesCS5A01G062100 chr5A 1240582 1241243 661 False 979.0 979 93.1390 1 681 1 chr5A.!!$F1 680
4 TraesCS5A01G062100 chr1A 432523261 432524806 1545 False 2715.0 2715 98.4480 1 1538 1 chr1A.!!$F1 1537
5 TraesCS5A01G062100 chr1A 20991730 20992388 658 True 1027.0 1027 94.4280 1 681 1 chr1A.!!$R1 680
6 TraesCS5A01G062100 chr6A 472969352 472970874 1522 False 2488.0 2488 96.0540 1 1538 1 chr6A.!!$F1 1537
7 TraesCS5A01G062100 chr6A 595510135 595511656 1521 True 2444.0 2444 95.5370 1 1538 1 chr6A.!!$R1 1537
8 TraesCS5A01G062100 chr6A 502544186 502544770 584 True 457.5 732 94.8300 1539 2204 2 chr6A.!!$R2 665
9 TraesCS5A01G062100 chr7A 722569868 722570969 1101 False 1930.0 1930 98.2760 1 1102 1 chr7A.!!$F3 1101
10 TraesCS5A01G062100 chr7A 677975067 677975935 868 False 1360.0 1360 95.0570 679 1539 1 chr7A.!!$F2 860
11 TraesCS5A01G062100 chr7A 668554759 668556477 1718 True 1128.0 1284 93.2515 1 1538 2 chr7A.!!$R1 1537
12 TraesCS5A01G062100 chr7A 609346772 609347430 658 False 1000.0 1000 93.6950 1 681 1 chr7A.!!$F1 680
13 TraesCS5A01G062100 chr5B 492815396 492816263 867 True 1358.0 1358 95.0460 679 1538 1 chr5B.!!$R1 859
14 TraesCS5A01G062100 chr4B 604143656 604144522 866 False 1351.0 1351 94.9250 679 1538 1 chr4B.!!$F1 859
15 TraesCS5A01G062100 chr4B 564153928 564155010 1082 False 442.0 442 89.9720 1 358 2 chr4B.!!$F2 357
16 TraesCS5A01G062100 chr3A 27583272 27584003 731 False 1195.0 1195 96.1750 810 1540 1 chr3A.!!$F1 730
17 TraesCS5A01G062100 chr3A 11597492 11599212 1720 True 1164.0 1334 94.0665 1 1537 2 chr3A.!!$R1 1536
18 TraesCS5A01G062100 chr4A 553534728 553535594 866 False 1317.0 1317 94.2330 679 1538 1 chr4A.!!$F1 859
19 TraesCS5A01G062100 chr6D 361415722 361416401 679 True 1151.0 1151 97.0890 1537 2222 1 chr6D.!!$R1 685
20 TraesCS5A01G062100 chr6B 543082052 543082739 687 True 1147.0 1147 96.8210 1537 2222 1 chr6B.!!$R1 685
21 TraesCS5A01G062100 chr2B 721722974 721723633 659 False 994.0 994 93.5580 1 681 1 chr2B.!!$F1 680
22 TraesCS5A01G062100 chr7B 692795215 692795874 659 False 856.0 856 89.9120 1 680 1 chr7B.!!$F1 679

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
170 173 2.174349 GGCGCGCAGACAAAGAAG 59.826 61.111 34.42 0.0 0.0 2.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1892 2147 0.179097 GGCGACATTGAGGAGGAGAC 60.179 60.0 0.0 0.0 0.0 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
170 173 2.174349 GGCGCGCAGACAAAGAAG 59.826 61.111 34.42 0.00 0.00 2.85
928 1141 6.151144 AGCCCCACGATTCTTATTTAATATGC 59.849 38.462 0.00 0.00 0.00 3.14
1460 1680 2.702592 TTTAGTGGGCCTAATCGTGG 57.297 50.000 4.53 0.00 35.59 4.94
1608 1830 3.120105 CCCGCACGAGAGCTCATA 58.880 61.111 17.77 0.00 0.00 2.15
1609 1831 1.437573 CCCGCACGAGAGCTCATAA 59.562 57.895 17.77 0.00 0.00 1.90
1610 1832 0.596083 CCCGCACGAGAGCTCATAAG 60.596 60.000 17.77 6.36 0.00 1.73
1892 2147 4.873129 CCCGGCGTGGATCACTCG 62.873 72.222 6.01 0.00 42.00 4.18
2059 2315 0.680061 GAAGAACCTGGTCTCACGGT 59.320 55.000 0.00 0.00 0.00 4.83
2112 2383 0.750850 ACCGATCATACGTGGAAGGG 59.249 55.000 0.00 4.43 0.00 3.95
2159 2430 2.296752 TCGTAGGATGTTTGGTGTCGAA 59.703 45.455 0.00 0.00 0.00 3.71
2218 2490 0.623723 AACAATATGGGCGAGTGGGT 59.376 50.000 0.00 0.00 0.00 4.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
170 173 1.017387 CTTATTTGCACCGCCTCTCC 58.983 55.000 0.00 0.0 0.00 3.71
1460 1680 4.282703 ACGTATACAGATCCAATACCACCC 59.717 45.833 3.32 0.0 0.00 4.61
1608 1830 2.161012 TCGATCTCGTGCGTAACTTCTT 59.839 45.455 0.00 0.0 40.80 2.52
1609 1831 1.736126 TCGATCTCGTGCGTAACTTCT 59.264 47.619 0.00 0.0 40.80 2.85
1610 1832 2.102633 CTCGATCTCGTGCGTAACTTC 58.897 52.381 0.00 0.0 40.80 3.01
1892 2147 0.179097 GGCGACATTGAGGAGGAGAC 60.179 60.000 0.00 0.0 0.00 3.36
1937 2192 1.271707 TGTGGTAAAAGGGGCTGTAGC 60.272 52.381 0.00 0.0 41.14 3.58
2059 2315 0.601558 GTCGCCTGTCAGGAGTTGTA 59.398 55.000 23.77 0.0 37.67 2.41
2136 2407 2.858344 CGACACCAAACATCCTACGATC 59.142 50.000 0.00 0.0 0.00 3.69
2159 2430 1.772063 GCAGCACACCGAACGACTTT 61.772 55.000 0.00 0.0 0.00 2.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.