Multiple sequence alignment - TraesCS5A01G046000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G046000 chr5A 100.000 5631 0 0 1 5631 41413558 41419188 0.000000e+00 10399
1 TraesCS5A01G046000 chr3B 99.396 5632 30 2 1 5631 555162747 555157119 0.000000e+00 10209
2 TraesCS5A01G046000 chr1B 98.175 5643 89 13 1 5631 654296309 654301949 0.000000e+00 9838
3 TraesCS5A01G046000 chr1B 83.043 1032 115 37 406 1399 468123814 468124823 0.000000e+00 881
4 TraesCS5A01G046000 chr2A 95.856 5671 173 36 1 5631 20644921 20650569 0.000000e+00 9114
5 TraesCS5A01G046000 chr2A 96.117 515 17 3 5117 5631 20644782 20645293 0.000000e+00 837
6 TraesCS5A01G046000 chr2A 94.456 487 23 3 5117 5602 736296423 736295940 0.000000e+00 747
7 TraesCS5A01G046000 chr2A 83.559 517 55 14 5117 5631 714011777 714012265 1.850000e-124 457
8 TraesCS5A01G046000 chr1D 94.355 5704 222 44 1 5631 332872580 332866904 0.000000e+00 8658
9 TraesCS5A01G046000 chr4A 93.547 5672 271 49 1 5631 271453034 271458651 0.000000e+00 8359
10 TraesCS5A01G046000 chr1A 93.507 5437 250 51 1 5390 272209955 272204575 0.000000e+00 7989
11 TraesCS5A01G046000 chr6B 95.847 4936 188 4 698 5631 581313309 581318229 0.000000e+00 7963
12 TraesCS5A01G046000 chr7B 99.569 4179 17 1 1 4178 702167282 702163104 0.000000e+00 7616
13 TraesCS5A01G046000 chr7B 99.070 430 4 0 1 430 702161603 702161174 0.000000e+00 773
14 TraesCS5A01G046000 chr4D 95.269 4164 123 31 524 4642 456255184 456259318 0.000000e+00 6530
15 TraesCS5A01G046000 chr5B 99.725 3277 8 1 1627 4902 606839755 606843031 0.000000e+00 6000
16 TraesCS5A01G046000 chr7A 90.038 2861 180 57 215 3034 81786028 81788824 0.000000e+00 3607
17 TraesCS5A01G046000 chrUn 99.690 1290 4 0 182 1471 415501103 415499814 0.000000e+00 2361
18 TraesCS5A01G046000 chr6D 87.850 749 65 19 679 1422 136935478 136934751 0.000000e+00 856


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G046000 chr5A 41413558 41419188 5630 False 10399.0 10399 100.0000 1 5631 1 chr5A.!!$F1 5630
1 TraesCS5A01G046000 chr3B 555157119 555162747 5628 True 10209.0 10209 99.3960 1 5631 1 chr3B.!!$R1 5630
2 TraesCS5A01G046000 chr1B 654296309 654301949 5640 False 9838.0 9838 98.1750 1 5631 1 chr1B.!!$F2 5630
3 TraesCS5A01G046000 chr1B 468123814 468124823 1009 False 881.0 881 83.0430 406 1399 1 chr1B.!!$F1 993
4 TraesCS5A01G046000 chr2A 20644782 20650569 5787 False 4975.5 9114 95.9865 1 5631 2 chr2A.!!$F2 5630
5 TraesCS5A01G046000 chr1D 332866904 332872580 5676 True 8658.0 8658 94.3550 1 5631 1 chr1D.!!$R1 5630
6 TraesCS5A01G046000 chr4A 271453034 271458651 5617 False 8359.0 8359 93.5470 1 5631 1 chr4A.!!$F1 5630
7 TraesCS5A01G046000 chr1A 272204575 272209955 5380 True 7989.0 7989 93.5070 1 5390 1 chr1A.!!$R1 5389
8 TraesCS5A01G046000 chr6B 581313309 581318229 4920 False 7963.0 7963 95.8470 698 5631 1 chr6B.!!$F1 4933
9 TraesCS5A01G046000 chr7B 702161174 702167282 6108 True 4194.5 7616 99.3195 1 4178 2 chr7B.!!$R1 4177
10 TraesCS5A01G046000 chr4D 456255184 456259318 4134 False 6530.0 6530 95.2690 524 4642 1 chr4D.!!$F1 4118
11 TraesCS5A01G046000 chr5B 606839755 606843031 3276 False 6000.0 6000 99.7250 1627 4902 1 chr5B.!!$F1 3275
12 TraesCS5A01G046000 chr7A 81786028 81788824 2796 False 3607.0 3607 90.0380 215 3034 1 chr7A.!!$F1 2819
13 TraesCS5A01G046000 chrUn 415499814 415501103 1289 True 2361.0 2361 99.6900 182 1471 1 chrUn.!!$R1 1289
14 TraesCS5A01G046000 chr6D 136934751 136935478 727 True 856.0 856 87.8500 679 1422 1 chr6D.!!$R1 743

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
458 600 3.545703 CAGAGCCGATTAAGGGTTTGAT 58.454 45.455 0.22 0.0 43.86 2.57 F
1794 2076 0.813610 GGGGGCAAAGCAACAACAAC 60.814 55.000 0.00 0.0 0.00 3.32 F
4172 4459 9.574516 AAATCTACACTGATGGAAGTTAAAACT 57.425 29.630 0.00 0.0 42.04 2.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1793 2075 6.757897 TGTCAATCTTGTGAAAAGAGTTGT 57.242 33.333 0.0 0.0 0.00 3.32 R
3614 3901 9.150348 GGTAATTCAACTAATTCCCAAACATTG 57.850 33.333 0.0 0.0 38.71 2.82 R
5404 6122 4.094887 AGTCGCACGCTGAATTTGAATTAT 59.905 37.500 0.0 0.0 0.00 1.28 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
147 287 7.531857 TGGTAAAGCCTGTGAATTTGAATTA 57.468 32.000 0.00 0.0 38.35 1.40
458 600 3.545703 CAGAGCCGATTAAGGGTTTGAT 58.454 45.455 0.22 0.0 43.86 2.57
1792 2074 1.382420 AGGGGGCAAAGCAACAACA 60.382 52.632 0.00 0.0 0.00 3.33
1793 2075 0.980231 AGGGGGCAAAGCAACAACAA 60.980 50.000 0.00 0.0 0.00 2.83
1794 2076 0.813610 GGGGGCAAAGCAACAACAAC 60.814 55.000 0.00 0.0 0.00 3.32
4172 4459 9.574516 AAATCTACACTGATGGAAGTTAAAACT 57.425 29.630 0.00 0.0 42.04 2.66
5404 6122 7.531857 TGGTAAAGCCTGTGAATTTGAATTA 57.468 32.000 0.00 0.0 38.35 1.40
5602 6320 9.617053 AATAGCACTATATAAAGGTCCCTAACT 57.383 33.333 0.00 0.0 0.00 2.24
5603 6321 7.932683 AGCACTATATAAAGGTCCCTAACTT 57.067 36.000 0.00 0.0 0.00 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
147 287 6.595326 TGAGTCGCACTCTGAATTTGAATTAT 59.405 34.615 14.6 0.0 45.27 1.28
458 600 6.729391 TTGATCCGACGATTAAACAAATCA 57.271 33.333 0.0 0.0 43.68 2.57
1792 2074 7.156876 TGTCAATCTTGTGAAAAGAGTTGTT 57.843 32.000 0.0 0.0 0.00 2.83
1793 2075 6.757897 TGTCAATCTTGTGAAAAGAGTTGT 57.242 33.333 0.0 0.0 0.00 3.32
1794 2076 7.475015 TCTTGTCAATCTTGTGAAAAGAGTTG 58.525 34.615 4.1 0.0 43.78 3.16
3614 3901 9.150348 GGTAATTCAACTAATTCCCAAACATTG 57.850 33.333 0.0 0.0 38.71 2.82
4011 4298 5.932661 TGACGTGATTGCATTATCGAAAAA 58.067 33.333 0.0 0.0 0.00 1.94
4172 4459 9.527157 TTCATGTCAAATTTAGAGGATAACCAA 57.473 29.630 0.0 0.0 38.94 3.67
5404 6122 4.094887 AGTCGCACGCTGAATTTGAATTAT 59.905 37.500 0.0 0.0 0.00 1.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.